Skip to content


  • Research article
  • Open Access

Identification, classification and evolution of Owl Monkeys (Aotus, Illiger 1811)

  • 1,
  • 2, 3 and
  • 1, 2Email author
BMC Evolutionary Biology201010:248

  • Received: 4 February 2010
  • Accepted: 12 August 2010
  • Published:



Owl monkeys, belonging to the genus Aotus, have been extensively used as animal models in biomedical research but few reports have focused on the taxonomy and phylogeography of this genus. Moreover, the morphological similarity of several Aotus species has led to frequent misidentifications, mainly at the boundaries of their distribution. In this study, sequence data from five mitochondrial regions and the nuclear, Y-linked, SRY gene were used for species identification and phylogenetic reconstructions using well characterized specimens of Aotus nancymaae, A. vociferans, A. lemurinus, A. griseimembra, A. trivirgatus, A. nigriceps, A. azarae boliviensis and A. infulatus.


The complete MT-CO1, MT-TS1, MT-TD, MT-CO2, MT-CYB regions were sequenced in 18 Aotus specimens. ML and Bayesian topologies of concatenated data and separate regions allowed for the proposition of a tentative Aotus phylogeny, indicating that Aotus diverged some 4.62 Million years before present (MYBP). Similar analyses with included GenBank specimens were useful for assessing species identification of deposited data.


Alternative phylogenetic reconstructions, when compared with karyotypic and biogeographic data, led to the proposition of evolutionary scenarios questioning the conventional diversification of this genus in monophyletic groups with grey and red necks. Moreover, genetic distance estimates and haplotypic differences were useful for species validations.


  • Phylogenetic Reconstruction
  • Junior Synonym
  • Genetic Distance Estimate
  • Neotropical Primate
  • Bayesian Reconstruction


The small-sized neotropical primates with unique nocturnal habits, known as "owl monkeys" or "night monkeys" are grouped in the genus Aotus. This genus is widespread across several biomes of South America, and in Panama at the northwestern part of its distribution (Figure 1). Several Aotus species have been extensively used as animal models for vaccine research, vision physiology and susceptibility to viral infections but few reports have focused on the taxonomy and phylogeography of this genus. Moreover, several surveys on the distribution of neotropical primates have not included owl monkeys because their nocturnal habit makes them elusive to field workers [1, 2].
Figure 1
Figure 1

Geographic distribution of Aotus species, from Hershkovitz [10]with modifications. The range of A. nancymaae, partially overlapping with A. nigriceps and A. vociferans is shown by a red/stippled line. Map shows type localities (place where holotype or type specimen was found) and sites of collection. Type localties: 1 = Argentina, right bank of Rio Paraguay (A. a. azarae); 2 = Bolivia, Prov. de Sara (A. a. boliviensis); 3 = Perú, Chanchamayo; 4 = Perú, San Nicolas; 5 = Perú, right bank of Rio Samiria; 6 = Brazil, Tabatinga; 7 = Colombia, East side of Cordillera; 8 = Colombia, Villavicencio; 9 = Colombia, Santa Fé de Bogotá; 10 = Colombia, Hacienda Cincinnati; 11 = Venezuela, Duida Range; 18 = Brazil, Belém do Pará. Sites of collection: 6 = Colombia, Letícia; 12 = Brazil, Santa Isabel do Rio Negro; 13 = Brazil, Barcelos, 14 = Brazil, Manaus; 15 = Brazil, Usina Hidroeletrica de Samuel; 16 = Brazil, Ilha de Marajó, 17 = Brazil, Usina Hidroeletrica de Tucuruí; 19 = Brazil, São Miguel.

Early taxonomic studies of Aotus were mainly based on pelage coloration [3] and karyotyping [48], leading to the revision of the taxonomic status of several species [9] and the description of new ones [10]. In Hershkovitz's taxonomic revision, two novel species were described, comprising a total of nine species divided in two groups with different pelage coloration (red neck and grey neck). Aotus taxonomy and evolution has also been analyzed based on morphologic, karyologic and carbonic anhydrase II electrophoretic data [11, 12] while phylogenetic reconstructions were later inferred based on partial cytochrome oxidase COII DNA data [13, 14]. A study of grey neck species [15], mainly based on karyotypic data, recognized at least seven species of this group, A. brumbacki, A. griseimembra, A. lemurinus, A. trivirgatus, A. vociferans, A. zonalis and a presumably novel one named A. jorgehernandezi.

The morphological similarity of Aotus species has led to frequent misidentifications, mainly at the borderlines of their distributions where more than one species might be captured at collecting sites. Care should be taken when selecting specimens for taxonomic and phylogenetic studies although the karyotype of most Aotus species is well known and might be useful for their identification. In fact, precise identification is crucial for biomedical studies using Aotus as animal models. Several studies suggested that grey neck species were susceptible to malaria contrary to the presumably resistant red neck species [10, 11] although the red neck species A. azarae boliviensis and A. infulatus were found to be susceptible to Plasmodium falciparum [16, 17] while different Plasmodium species or strains showed varying degrees of pathogenicity among Aotus species. Similarly, different Aotus species displayed manifold phenotypes to HIV-1 restriction by tetherin [18], an integral membrane protein that prevents budding of nascent retroviral particles in infected cells [19]. Tetherin alleles from A. nancymaae and A. vociferans potently restricted HIV-1 replication while those from A. griseimembra failed to do so, showing that closely related species might express different restriction phenotypes [20]. These findings are illustrative of the need of precise species identification for validating biomedical research.

Here we report a study of Aotus with five mitochondrial DNA sequences and one Y-linked gene and used these markers for species identification and phylogenetic reconstructions. This allowed us to reassess several GenBank specimens, analyze the species status of Aotus taxa and infer putative evolutionary scenarios based on biogeographic and karyotypic data.



We analyzed 18 Aotus specimens belonging to eight Aotus taxa and two Saimiri sciureus (Table 1). Figure 1 shows the geographic distribution of Aotus species and sites of collection. Skull and skins of Aotus trivirgatus (TR1 and TR2; field numbers CRB1479 and CRB2597, respectively) were deposited in the mammal collections of Museu Nacional (MN), Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil (catalog numbers MN69297 and MN53667, respectively).
Table 1

List of specimens herein sequenced, with identification (ID), field number, species, sex, place of collection and GenBank accession number



Field Number


Place of collection

GenBank MT-CO1 to MT-CO2

GenBank MT-CYB

GenBank SRY


A.a. boliviensis


Samuel, Rondônia, BR





A.a. boliviensis


Samuel, Rondônia, BR

[GenBank: HQ005473]




A. infulatus



São Miguel, Maranhão, BR

[GenBank: HQ005474]




A. infulatus


São Miguel, Maranhão, BR

[GenBank: HQ005475]


[GenBank: HQ018924]


A. infulatus


Ilha do Marajó, Pará, BR

[GenBank: HQ005476]




A. nigriceps


São Paulo Zoo, São Paulo, BR

[GenBank: HQ005478]




A. nigriceps


CPRJ, Rio de Janeiro, RJ





A. lemurinus


UFPA, Pará, BR





A. griseimembra


San Marcos, Colombia





A. griseimembra


San Marcos, Colombia





A. trivirgatus


Rio Aracá, Amazonas, BR1





A. trivirgatus


Rio Padauiri, Amazonas, BR2





A. trivirgatus


Manaus, Amazonas, BR





A. vociferans



Letícia, Colombia





A. vociferans


Letícia, Colombia





A. nancymaae



Letícia, Colombia





A. nancymaae



Letícia, Colombia


[GenBank: HQ005507]



A. nancymaae



Letícia, Colombia





Saimiri sciureus








Saimiri sciureus







? = unknown; * = wild caught; ** = previously reported sequences; 1 = 0°32'N, 63°31'W; 2 = 0°18'N, 64°01'W; BR = Brazil.

DNA isolation, amplification and sequencing

DNA was extracted from blood or liver tissue preserved in ethanol following standard procedures [21]. Cytochrome b DNA was amplified with primers L14724 [22] and Citb2 [23], and amplified products were labeled with primers Citb AloAotR [24] and Citb AloAotF [24], Citb Alo [23] and Citb Aot (5'-CATGAGGCCAAATATCATTCTGAGG-3'). Cytochrome Oxidase Units I and II were amplified with two primer pairs: CO1F/CO1R (5'-ATGCTTACTCAGCCATTTTA-3' and 5'-TTTGAGGAGAAAGCTTCTC-3' respectively) and CO1F3/CO2R2 (5'-TTGCTATCCCTACTGGGGTAAA-3' and 5'-GGTCTTTAACTTAAAAGGTTAATGCTARRTA-3' repectively). Amplified products were sequenced with primers CO1R2 (5-AATGGCTCCTAGAATTGAAGAAA-3), CO2F1 5' CTCCTCCTTATCACACATTT 3') and CO2F2 (5' TAACYCACACCAGCACCATA 3'). SRY DNA was amplified with primers SRY- [25] and SW2 [26]; internal primers SRY 2i- and SRY 2i+ were used for sequencing [25]. Cytochrome b DNA of A. griseimembra and A. trivirgatus has been previously reported [20].

All fragments were amplified under the following conditions: 94° (3 min); 35 cycles of 94° (30 sec), 55° (45 sec), 72° (90 sec); and a final extension of 72° (3 min). Amplified products were purified using Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). Sequencing was carried out with ABI Prism™ 377 and ABI 3730 DNA Analyzers, manually aligned with Chromas Lite version 2.01 [27] and Bioedit [28] and deposited in GenBank.

Nomenclature of mitochondrial DNA sequences were MT-CO1 for cytochrome C oxidase subunit I, MT-TS1 for tRNA serine 1, MT-TD for tRNA aspartic acid, MT-CO2 for cytochrome C oxidase subunit II, MT-CYB for cytochrome b, and SRY for the Y chromosome "sex determining region Y" gene following HGNC rules (latest accession on January 2010 [29, 30]).

Analyses of molecular data

Separate analyses were carried out with the following DNA datasets: (1) Dat-CON, with concatenated MT-CO1, MT-CO2 and MT-CYB sequences; (2) Dat-CO1, with MT-CO1 sequences; (3) Dat-CO2, with MT-CO2 sequences; (4) Dat-CYB, with MT-CYB sequences. (5) Dat-SRY, with SRY sequences. A partition homogeneity test [31] implemented in PAUP* 4.0b10 [32] was performed using 1,000 replications and 100 random addition replicates to compare phylogenetic signals between different data partitions in Dat-CON.

A complete mitochondrial DNA sequence of Cebus albifrons ([GenBank:AJ309866]) and MT-CO1, MT-TS1, MT-TD, MT-CO2, MT-CYB data from two Saimiri sciureus sequenced by us (SA1 and SA2) were used as outgroups as was the SRY DNA sequence of Cebus albifrons ([GenBank:AF338385]).

The best model of evolution for each dataset was estimated with the Akaike information criterion test [33] with modifications (AIC2) [34] and the Bayesian Information Criterion (BIC) [35] with Modelgenerator 0.85 [36]. Estimates of sequence divergence were calculated and constructed with pairwise deletion using PAML 4.4 [37] except for Dat-SRY due the low number of variable sites. Maximum likelihood (ML) trees were obtained with PAUP* 4.0b10 [32] by heuristic searches with the tree-bisection-reconnection algorithm (TBR) and 100 random addition sequences. Additionally, 1,000 bootstrap replicates indices were obtained with GARLI version 0.96 [38] (available in Bayesian posterior probabilities were computed using the Metropolis-coupled Markov chain Monte Carlo method (MCMCMC) with MrBayes 3.1.1 [39], by running four chains with 20,000,000 generations. Trees were sampled every 100 generations and the first 10% were discarded as the "burn-in" phase before computing a consensus tree with PAUP*. Bayesian posterior probabilities (PP) were obtained from the 50% majority rule consensus of the remaining trees. Bayesian analyses for Dat-CON were performed in a partitioned framework, allowing specific parameter estimation for each locus. Comparisons of alternative topologies (Additional file 1) were carried out with BASEML of PAML 4.4 package [37].

The time of divergence between species was estimated with Dat-CON using a Bayesian Markov chain Monte Carlo (MCMC) algorithm with BEAST 1.5.3 [40], with unlinked substitution and unlinked relaxed clock [41] models for each gene. We used 21.81 ± 1.24 Million years before present (MYBP) as the time of divergence of Aotus from Cebus/Saimiri, and 19.05 ± 1.5 MYBP as the time of divergence of Cebus from Saimiri [42], with a normal prior distribution, a randomly generated starting tree and chain length of 20,000,000 generations with parameter samples every 1,000 steps. Monophyletic taxon sets were assumed for congruence with topologies produced by ML and Bayesian phylogenetic reconstructions. For acceptable mixing and convergence to the stationary distribution, the first 10% were discarded as burn-in using Tracer [43] and TreeAnnotator 1.5.4 of BEAST 1.5.3 [40] package.

Additionally, GenBank sequences from several Aotus specimens (Table 2) were compared with analogous datasets (Dat-CO1, Dat-CO2 and Dat-CYB). ML and Bayesian phylogenetic reconstructions were carried out using the same parameters as above, although branch lengths were not estimated because several GenBank specimens contained only partial sequence data. Only Cebus albifrons was used as outgroup in the analysis of MT-CO2 sequences from GenBank.
Table 2

GenBank specimens, DNA sequenced region, size in base pairs (bp), position of the first nucleotide respective to our sequence data (1st bp = first bp)


DNA sequence



Identification in GenBank and publications

Identification according to position in topologies


All MT*



A. trivirgatus

A. griseimembra


All MT*



Cebus albifrons






A. azarae

Not confirmed





A. azarae

Not confirmed





A. azarae

Not confirmed





A. azarae

Not confirmed





A. azarae

Not confirmed





A. azarae

Not confirmed





A. azarae

Not confirmed





A. nancymaae (1)






A. nancymaae






A. nancymaae






A. nigriceps






A. nigriceps






A. nigriceps






A. vociferans






A. vociferans






A. nancymaae (2)






A. l. griseimembra (2)






A. l. griseimembra (2)






A. l. griseimembra (2)






A. a. boliviensis (2)

Not confirmed





A. nancymaae (3)






A. nancymaae (3)






A. l. griseimembra (3)






A. nigriceps (3)

A. trivirgatus





A. vociferans (3)






A. vociferans (3)






A. brumbacki (3)






A. a. azarae (3)

A. nigriceps





A. nancymaae (4)

A. griseimembra





A. nancymaae (4)

A. griseimembra





Cebus albifrons






A. a. azarae (5)

Not confirmed

(1) Lorenz et al. [61]; (2) Ashley and Vaughn [13]; (3) Plautz et al. [14]; (4) Lavergne et al. [62]; (5) Ascunce et al. [63]; * = mtDNA including MT-CO1 to MT-CO2 and MT-CYB; ** = Nuclear mitochondrial DNA insertion. Karyotypic data were reported for species shown in bold.

Aminoacid sequences were deduced, for MT-CO1, MT-CO2, MT-CYB and the coding region of SRY (nt 177 - 803) using MEGA 4.02 [44]. The best models of evolution for each deduced protein were obtained using the same parameters as above. ML topologies with 1,000 bootstrap replicates were constructed with PHYML 3.0 [45] and Bayesian phylogenetic reconstructions were carried out as previously described.

Karyotypic analyses

Cell suspensions of A. nigriceps NI2 were prepared with short-term cultures of 46 hours in Dulbecco's minimal essential medium, enriched with fetal serum (20%), phytohemagglutinin (2%), and colchicine (10-6 M) during the last two hours. Short term, bone marrow cultures of TR1 female specimen of A. trivirgatus from Barcelos were prepared in the field and incubated for 2-hours in RPMI 1640 medium, fetal calf serum (20%), colchicine (10-6 M) and ethidium bromide (5 μg/mL).


Gene markers

The complete MT-CO1, MT-TS1, MT-TD, MT-CO2, MT-CYB genes were sequenced in 18 Aotus specimens belonging to eight taxa (Table 1) and Saimiri sciureus SA1 and SA2 except for the initial 9 bp region of the MT-CO1 5'-region of SA2. A region containing five SRY regions (832 pb) was also sequenced: (1) the untranslated region upstream of the start codon (nt 1-176), (2) the codon region upstream of the HMG box (nt 177-350), (3) the HMG box domain (nt 351-582), (4) the downstream coding region (nt 583-800), (5) the untranslated downstream region (nt 801-829) from at least one specimen of the following species: A. azarae boliviensis, A. infulatus, A. nigriceps, A. trivirgatus, A. vociferans, A. lemurinus and A. griseimembra (Table 1). The size of each Dataset, number of specimens, haplotypes, variable sites, parsimony informative sites, number of protein variable sites and number of deduced proteins are listed in Table 3. Genetic distance estimates are shown in Table 4.
Table 3

Comparisons of different datasets, dataset size (in base pairs = bp), number of Aotus specimens, number of taxa, number of haplotypes, variable sites (in DNA), parsimony informative sites per dataset, number of variable sites in deduced proteins, and number of different proteins in coding regions per individual gene dataset


Size (bp)

Number of specimens

Number of taxa

Number of haplotypes

Variable sites (DNA)

Parsimony Informative Sites

Variable sites (protein)

Number of proteins














































Table 4

Intraspecific and interspecific genetic distance estimated with the HKY + G model in each dataset showing lower and higher estimates or single estimates.







A. a. boliviensis

A. a. boliviensis






A. infulatus






A. nigriceps






A. trivirgatus






A. vociferans






A. nancymaae






A. griseimembra






A. lemurinus





A. infulatus

A. infulatus






A. nigriceps






A. trivirgatus






A. vociferans






A. nancymaae






A. griseimembra






A. lemurinus





A. nigriceps

A. nigriceps






A. trivirgatus






A. vociferans






A. nancymaae






A. griseimembra






A. lemurinus





A. trivirgatus

A. trivirgatus






A. vociferans






A. nancymaae






A. griseimembra






A. lemurinus





A. vociferans

A. vociferans






A. nancymaae






A. griseimembra






A. lemurinus





A. nancymaae

A. nancymaae






A. griseimembra






A. lemurinus





A. griseimembra

A. griseimembra






A. lemurinus





Intraspecific values are shown in bold

Comparisons with Cebus albifrons SRY ([GenBank:AF338385]) showed a minimum of 45 nucleotide substitutions and one deletion in all Aotus corresponding to nucleotides 672 to 674 of C. albifrons.

Phylogenetic analyses of DNA sequences

The partition homogeneity test did not show significant differences between loci (p = 0.116; p ≥ 0.05) supporting the congruence and subsequent combination of the three mitochondrial genes for ML analysis. Also, the Hasegawa-Kishino-Yano model [46] with Gamma shape parameter (HKY + G) was indicated by AIC2 and the BIC tests for phylogenetic reconstructions using all mitochondrial sequences datasets. For SRY analysis, both tests indicated the Kimura's 2-parameter model (K80) [47].

The ML topology resulting from analysis of SRY data (Figure 2) showed three collapsed lineages: one leading to A. vociferans, a second one leading to A. griseimembra and A. lemurinus, and a third one leading to A. trivirgatus A. nigriceps A. azarae boliviensis, and A. infulatus.
Figure 2
Figure 2

Topologies derived from Dat-SRY analyses. A) ML topology obtained with heuristic search, 100 random addition sequence and K80 model. Numbers near nodes correspond to bootstrapping frequencies ≥ 60 estimated with 1,000 replicates. Arrows indicate SRY mutations (base pair position and nucleotide substitutions). B) 50% majority rule consensus topology of 18,000 sampled trees. Numbers at nodes indicate Bayesian proportions.

ML and Bayesian reconstructions using Dat-CON showed two sister lineages (Figure 3A-B), one leading to the most basal offshoot represented by A. nancymaae and another to a clade grouping the seven other Aotus taxa. This clade split in two sister lineages, one leading to A. vociferans and the other one further splitting in (A. griseimembra, A. lemurinus) and to a more derived clade (A. trivirgatus (A. nigriceps (A. infulatus, A. azarae))).
Figure 3
Figure 3

Concatenated genes topologies. Red bars and grey bars indicate red neck and grey neck species, respectively. A) ML topology, with heuristic search, HKY + G model; 100 random addition sequence. Numbers correspond to bootstrapping frequencies ≥ 60 estimated with 1,000 replicates; Arrow indicates Cytosine insertion in MT-TS1. B) 50% majority rule consensus topology of 18,000 sampled trees. Numbers at nodes indicate Bayesian proportions. Arrows indicate divergence times in MYBP (Height and 95% height posterior density intervals). Lineages leading to Cebus albifrons and Saimiri sciureus were reduced for better resolution of Aotus lineages.

Two ML topologies resulting from analysis of Dat-CO1 and the consensus topology (Additional file 2A) showed a similar arrangement to the one resulting from Dat-CON analysis, except that NA2 did not group with the other A. nancymaae specimens. Bayesian reconstruction (Additional file 2B) was identical with the Dat-CON topology.

The ML topology produced by analysis of Dat-CO2 (Additional file 3A) showed few differences with the one produced by Dat-CON, with a paraphyletic arrangement of A. infulatus while, in the Bayesian reconstruction (Additional file 3B), specimen IN3 grouped with A. azarae boliviensis (AB1 and AB2) rather than with other A. infulatus (IN1 and IN2). Moreover, the branches leading to A. vociferans, A. lemurinus and A. griseimembra collapsed in the Bayesian topology.

The ML topology derived from Dat-CYB (Additional file 4A) showed two clades, one grouping (A. vociferans (A. trivirgatus (A. nigriceps (A. azarae boliviensis, A. infulatus)))), and another grouping (A. nancymaae (A. griseimembra, A. lemurinus)) while, in the Bayesian reconstruction (Additional file 4B) the branches leading to A. vociferans and A. nancymaae collapsed, as was also the case of the branch leading to A. griseimembra and A. lemurinus.

Comparisons between different topologies using Dat-CON, carried out with BASEML are shown in Additional file 1. These trees were constructed taking in consideration the differences between the following topologies: (1) Dat-CON ML (Figure 3A); (2) Dat-CO2 Bayesian (Additional file 3B); (3) Dat-CYB ML (Additional file 4A); (4) Dat-CYB Bayesian (Additional file 4B); (5) Dat-CON ML (Figure 3A) with collapsed low supported lineages (A. nancymaae, A. vociferans, A. lemurinus and A. griseimembra); (6) Dat-CO2 ML (Additional file 3A) with collapsed low supported lineages (A. nancymaae, A. vociferans, A. lemurinus/A. griseimembra and A. trivirgatus). Topology 1 showed the highest RELL bootstrap proportion (pRELL = 0.79) although topologies 3 and 4 could not be rejected by the Shimodaira and Hasegawa test [48] (p-values = 0.62 and 0.48 respectively) despite showing lower pRELL (0.19 and 0.01 respectively). Conversely, topologies 2, 5 and 6 where discarded (p-values = 0.02, 0.01 and 0.03 respectively).

Phylogenetic analyses of deduced protein sequences

The AIC2 and BIC test indicated the MtMam model [49] with invariable sites parameter (MtMam+I) as the best model phylogenetic reconstructions based on MT-CO1 and MT-CO2 protein data, while MtMam with Gamma shape parameter (MtMam+G) was indicated for MT-CYB, and the Jones-Taylor-Thornton (JTT) [50] model for SRY. Analyses of aminoacid sequences (Additional file 5) showed different arrangements and less supported nodes than their respective ML nucleotide topologies. Comparisons of protein and nucleotide ML topologies showed the following differences: (1) A. infulatus (IN2), A. azarae boliviensis (AB1), A. nigriceps (NI2) and A. trivirgatus (TR3) shared the same SRY protein sequence; (2) A. azarae boliviensis (AB1, AB2) and A. infulatus (IN1, IN2, IN3) shared the same MT-CO1 protein sequence, as was the case of A. griseimembra (GR1, GR2) with A. trivirgatus (TR3), and of A. vociferans (VO1) with A. nancymaae (NA2). On the other side, another A. vociferans (VO2) appeared as the most basal lineage; (3) A. trivirgatus (TR1, TR2, TR3) shared the same MT-CO2 protein sequence, A. azarae boliviensis (AB1, AB2), A infulatus (IN1, IN2, IN3), A nigriceps (NI1, NI2), A lemurinus (LE1), A griseimembra (GR2), A vociferans (VO1, VO2) and A. nancymaae (NA1, NA2, NA3) shared another protein sequence while one A. griseimembra (GR1) showed a third protein. Furthermore, the topology did not group Saimiri with Cebus; (4) the MT-CYB protein arrangement showed a clade (A. trivirgatus (A. vociferans (A. lemurinus (A. griseimembra)))) with A. nancymaae specimens as three basal lineages.

Analysis of GenBank data

ML topologies resulting from the inclusion of GeneBank specimes with Dat-CO1 (Figure 4A), Dat-CO2 (Figure 4B) and Dat-CYB (Figure 4C) show the position of GenBank specimens. A comparison between GenBank identification and identification based on topologic positions is listed in Table 2.
Figure 4
Figure 4

Topologies resulting from analyses of Dat-CO1, Dat-CO2 and Dat-CYB with included GenBank sequences. ML topologies, with heuristic search, HKY + G model; 100 random addition sequence. Numbers correspond to bootstrapping frequencies ≥ 60 estimated with 1,000 replicates. Numbers below nodes indicate Bayesian proportions of 18,000 sampled trees. A) Dat-CO1 with included GenBank data; GenBank sample AY972694 shares an MT-CO1 region with both NA1 and NA3; B) Dat-CO2 with included GenBank data; C) Dat-CYB with included GenBank data.

Karyotypic analyses

Karyotypic analysis of the male specimen NI2 showed a diploid number (2n) of 51 chromosomes corresponding to the diploid and arrangement of A. nigriceps Karyotype VII previously described by Ma et al. [8]. Analysis of the Aotus trivirgatus female showed 2n = 50; the chromosome complement containing 12 pairs of biarmed chromosomes varying in size from large to small, and 13 pairs of acrocentric chromosomes varying in size from medium to small.


Molecular markers and species identification

Our findings showed different MT-CO1, MT-CO2, MT-CYB and SRY haplotypes between Aotus species although some SRY haplotypes differed by only one nucleotide (see Figure 2A), as was the case of A. infulatus (IN2) when compared to A. azarae boliviensis (AB1) and A. nigriceps (NI2).

Identification based on MT-CO2 was shown to be unreliable for closely related species in view of (i) small gene size, (ii) relative paucity of parsimony informative sites, and (iii) low genetic distance between species.

Species identification of several GenBank specimens was confirmed while the identification of other specimens was reassessed (see Table 2). The identification of 7 A. azarae specimens ([GenBank:EF658652] - [GenBank:EF658656, GenBank:EU179516, GenBank:EU179517]) and one A. azarae boliviensis ([GenBank:U36846]) could not be confirmed because only partial sequence data were available, lacking phylogenetic resolution. Specimen [GenBank:DQ321669], reported as A. brumbacki, could not be confirmed because only partial sequence data were available and a reference specimen was not available for comparison. Finally, specimen [GenBank:AF181085], reported as A. a. azarae, with a presumably complete MT-CO2 sequence, grouped with Saimiri sciureus. This sequence presented several sites with missing or ambiguous data and lacked a stop codon, suggesting a nuclear mitochondrial DNA insertion (Numt).

Phylogenetic considerations

Analyses of the different datasets showed that Dat-CO1 contained the highest number of PI sites (182), closely followed by Dat-CYB (181), while Dat-CO2, showed the lowest number (66). This might be related to the smaller size of MT-CO2 (696 bp) respective to MT-CO1 (1,557 bp) and MT-CYB (1,140 bp) although a similar number of PI sites was found in these two last genes regardless of their difference in size. These findings, and the fact that several MT-CO2 intraspecific distance estimates were higher than interspecific estimates, and lack of resolution between A. azarae and A. infulatus, indicated that MT-CO2 was the least reliable marker for analyzing Aotus phylogeny. Thus, phylogenetic reconstructions based on MT-CO2 [13, 14] must be carefully reconsidered.

Phylogenetic reconstructions resulting from Dat-CON provided the most coherent topologies (ML and Bayesian), with strong support for most branches while analysis of MT-CO1 resulted in very similar phylogenetic reconstructions, only differing by the position of NA2 in the ML topology (Additional file 2A). In the MT-CO1 protein topology (Additional file 5B), however, the shared sequence between A. griseimembra and A trivirgatus pointed to the close relation of these two grey neck species although A. lemurinus failed to group with A. griseimembra. On the other hand, the MT-CO1 protein shared by the red neck species A. nancymmae and the grey neck species A. vociferans indicated a close relation between them. Analyses of MT-CO2 showed paraphyletic arrangements in both ML and Bayesian topologies (Additional file 3) while the MT-CO2 protein topology (Additional file 5C) could only distinguish A. trivirgatus species apart from the others. The MT-CYB ML topology (Additional file 4) differed from all other DNA topologies by showing a weakly supported grouping of A. griseimembra/A. lemurinus with A. nancymaae (two grey neck species with one red neck species). The MT-CYB protein topology (Additional file 5D) showed one cluster of red neck species, a second cluster grouping all grey neck species, and placed the red neck A. nancymaae specimens as basal offshoots.

The monophyly of Aotus was corroborated by a single three base deletion in Aotus respective to Cebus SRY (Figure 2). SRY from A. vociferans (VO2), A. griseimembra (GR2) and A. lemurinus (LE1) shared two synapormophies (C and A at positions 306 and 593, respectively) with Cebus albifrons. The grouping of the red neck species A. nigriceps, A. infulatus, A. azarae boliviensis with the grey neck species A. trivirgatus in the SRY topology and the common SRY protein sequence shared by these species (Additional file 5A) coincided in showing their close relation.

Evolutionary, karyological and taxonomic considerations

Our phylogenetic reconstructions question the classical grouping of red neck and grey neck species proposed by Hershkovitz [10]. All phylogenetic reconstructions based on mtDNA showed that the lineage leading to the grey neck species A. trivirgatus was a sister lineage of the one leading to the red neck clade (A. nigriceps (A. azarae, A. infulatus)). If the proposed topologies were accepted as a valid representation of the evolutionary divergence of Aotus the red neck pelage trait must had appeared independently in A. nancymaae and in the red neck clade (A. nigriceps (A. azarae, A. infulatus)) and this would also be acceptable in the event of an alternative polytomy (Figure 5) which might be proposed in view of the low value of bootstrap and posterior probability indices at some nodes (Figure 3, Additional files 2 and 3). Moreover, phylogenetic reconstructions based on SRY and MT-CO1 protein sequence data showed close relations between red neck and grey neck species; this latter topology as well as the MT-CYB topology (Additional file 5D) corroborated that the red neck trait was not monophyletic. On the other hand, the monophyly of the grey neck group was only apparent in the MT-CYB topology, albeit with low support.
Figure 5
Figure 5

Proposed scenarios of Aotus evolution. Left: Tentative Aotus phylogeny as indicated by Dat-CON analyses based on 8 Aotus species herein analyzed. The presumptive positions of A. miconax, A. brumbacki and A. zonalis are based on biogeographic and karyotypic data [11, 15]. Diploid chromosome number (2n) is indicated. This arrangement requires at least two separate events accounting for red neck pelage. Right: Alternative polytomy resulting from collapsed branches. This arrangement also requires at least two separate events accounting for red neck pelage.

Lack of SRY data from A. nancymaae does not allow us to infer the position of this species using this nuclear marker. Analyses of carbonic anhydrase II biochemical patterns, karyology and morphology suggested that Aotus split in two separate clades, one comprising the red neck species and another with the grey neck species [11]. Cytonuclear discordances, as the ones resulting from differences between nuclear and mtDNA phylogenic reconstructions might well result from retention of ancestral polymorphisms during a short time of evolutionary divergence or reticulate evolution represented by historic episodes of hybridisation.

Biogeographic data indicate that red neck species are distributed south of the Solimões-Amazonas River and grey neck species north of this river except for the red neck A. nancymaae and the grey A. vociferans, the only Aotus species occurring north and south this river, and in sympatry in some localities [10] (Figure 1). Contrary to the proposition of Hershkovitz [10], that A. nancymaae emerged south of the Solimões-Amazonas, originating all other red-neck species and migrating to the north of this river, our phylogenetic reconstructions indicate the alternative possibility that A. nancymaae might have emerged north of the Solimões-Amazonas, originating the grey-neck group, in agreement with the proposed geographic origin of the ancestral Aotus population [11].

Altogether, the genus Aotus comprises a suite of karyotypically rearranged species consequently to extensive shuffling of their chromosome complement respective to other neotropical primates and man. This has been demonstrated by reciprocal chromosome painting between humans and A. nancymaae as well as with A. nancymaae chromosomes painted with wooly monkey whole chromosome probes [51]. This study showed that A. nancymaae karyotype that only three human syntenic groups were conserved, coexisting with 17 derived human homologous associations, while a minimum of 14 fissions and 13 fusions were required to derive the A. nancymaae karyotype from that of the ancestral karyotype of neotropical primates.

The monophyly of the red neck species A. azarae, A. infulatus and A. nigriceps was in agreement with karyologic data showing that they shared the same X1X1X2X2/X1X2Y sex chromosome system, contrary to other species with an XX/XY sex chromosome system (Figure 5). In all analyses based on DNA sequence data, the grey neck A. trivirgatus was the closest species to this red neck group, suggesting that A. azarae/A. infulatus/A. nigriceps might have originated from a more recent common ancestor with A. trivirgatus in eastern Amazonia, rather than in western Amazonia from an older common ancestor with A. nancymaae (a species with an XX/XY sex chromosome system). Determining the sex chromosome system of A. trivirgatus might be elucidating for a better understanding of this scenario.

Aotus trivirgatus showed 2n = 50 one female (TR1) from Barcelos (Amazonas State, Brazil), at the southwestern limit of its distribution (Figure 1). Recently, a new Aotus species, A. jorgehernandezi, has been described based on karyotypic data of a female specimen of unknown provenance [15, 52] with the same diploid number as the Aotus trivirgatus karyotyped by us. Other specimens collected near Manaus, with 2n = 52 in one female, 2n = 51 in one male, and 2n = 51 or 52 in another male, were previously attributed to A. trivirgatus [53]. However, as the distribution of Aotus species were not clearly delimited, their identification is questionable; in fact Manaus (Figure 1) is located at the confluence of the distribution of A. vociferans, A. nigriceps and A. trivirgatus.

Aotus specimens captured in Samuel Hydroeletric dam reservoir, the same locality of our A. azarae boliviensis specimes, showed a 2n♂ = 49; 2n♀ = 50 karyotype [54]. The karyotypic similarity between A. infulatus and A. azarae suggested a close proximity and recent common ancestry, a finding coincident with their low interspecific distance estimates and their unresolved arrangement when analyzing Dat-CO2, and by the recent time of their evolutionary divergence (0.53 MYBP; Figure 2B).

Aotus azarae boliviensis separated from A. infulatus when analysing Dat-CON, Dat-CO1 and Dat-CYB (Figures 2, Additional files 2 and 4); the insertion of one cytosine in position 59 of MT-TS1 in all A. azarae boliviensis being exclusive of this species. These differences as well as the presence of different SRY haplotypes justify the status of A. infulatus as a valid species rather than a junior synonym of A. azarae [55]. This taxonomic arrangement implies that the eastern distribution of A. azarae is limited by the rivers Tapajós-Juruema. We agree with Silva Jr & Fernandez [56] and Silva Jr et al. [57] in considering the A. infulatus distribution from southeast Amapá, north of the Amazonas River and the Islands of the mouth of the Amazonas to south of this river, from the Rio Tapajós, in the west, to the left bank to Rio Parnaíba in the east (Figure 1).

Nictipithecus felinus von Spix, 1823 was considered a junior synonym of A. infulatus by Elliot [58] and a junior synonym of A. trivirgatus by Groves [55]. Nictipithecus felinus was first described with an ochraceus neck (similar to A. infulatus and unlike the grey neck A. trivirgatus) and illustrated by von Spix [59] in his original description, while the illustration of Nictipithecus vociferans showed a grey neck. The N. felinus holotype was collected in "les environs de la capitale de Pará", or nearby Belém, the capital of Pará state (Brazil). These findings indicated that Nictipithecus felinus was a junior synonym of A. infulatus, a reason why we restrict the type locality of A. infulatus to Belém, Pará state, Brazil.

Our findings indicated that A. lemurinus, A. griseimembra and A. vociferans are valid species. This is because genetic distance estimates between A. lemurinus and A. griseimembra were higher than many other interspecific estimates and even higher when comparing A. vociferans with A. lemurinus and A. griseimembra (Table 4), and because A. lemurinus and A. griseimembra differed by more SRY replacements than between any two sister lineages in our ML topology (see Figure 2). These findings argue against the proposition that A. lemurinus and A. griseimembra are junior synonyms of A. vociferans [11] and in agreement with a recent karyologic study [15] indicating that these species are valid taxa.

Our findings indicated that the genus Aotus diverged some 4.62 MYBP (with 95% HPD intervals of 3.07 - 6.43 MYBP), and probably before the previous estimate of 3.3 MYPB [13]. Ma [60] suggested that geographic isolation in geographic niches led to karyotypic diversity in Aotus. According to Plautz et al. [14], the 100m rise of sea level over the past 5 million years probably allocated Aotus species in three refuge groups, one comprising A. vociferans, A. lemurinus, A. griseimembra in the Andean foothills, A. trivirgatus in the northwestern Guyanan shield, and A. nigriceps, A. azarae, A. infulatus and A. nancymaae in the Brazilian shield refuge. Our findings suggested that A. nancymaae should be included in the Andean foothill refuge rather than in the Brazilian shield refuge (Figure 5) and that A. nigriceps, A. azarae and A. infulatus must have diverged after the rise of sea level while grey neck species and A. nancymaae could have diverged before this event.


Our findings provided a tentative phylogenetic reconstruction of Aotus and considered an alternative polytomy based on the low support of some critical nodes. Regardless of these alternatives, however, comparisons with biogeographic and karyotypic data led to the proposition of an evolutionary scenario that questioned the classical division of Aotus in grey and red neck groups. Comparisons of GenBank sequences with data from well characterized specimens were useful for assessing the identification of deposited specimens. Our findings further indicated that A. infulatus, A. lemurinus, A. griseimembra and A. vociferans are valid species based on genetic distances and haplotypic differences.



We are indebted to Alcides Pissinatti, Paulo Castro, Arthur Silva, Maria Paula Schneider, Horácio Schneider and Iracilda Sampaio for providing samples. We are also grateful to Fabricia Nascimento and Miguel A.M. Moreira for useful comments and to Aline Moreira (Plataforma Genômica - Sequenciamento de DNA/PDTIS-FIOCRUZ, Brazil) for collaborating with sequecing. This article is part of the PhD requirements of Albert Rahul Eugene Antão Nobre de Menezes at the Universidade Federal do Rio de Janeiro who is a recipient of a CAPES scholarship. Work supported by CNPq grants 301424/2004-7 and 4744409/2006-6 and FAPERJ grants.

Authors’ Affiliations

Departamento de Genética, Universidade Federal do Rio de Janeiro, Cidade Universitária, 21949-570 Rio de Janeiro, RJ, Brazil
Programa de Genética - Instituto Nacional de Câncer, Rua André Cavalcanti, 37 - 4° andar, 20231-050 Rio de Janeiro, RJ, Brazil
Laboratório de Biologia e Parasitologia de Mamíferos Reservatórios Silvestres, Instituto Oswaldo Cruz, Rio de Janeiro, RJ, Brazil


  1. Nunes AP, Ayres JM, Martins ES, Silva JS: Primates of Roraima (Brazil) I. Northeastern Part of the Territory. Boletim do Museu Paranaense Emílio Goeldi Série Zoológica. 1988, 4 (1): 92-Google Scholar
  2. Nunes AP, Ayres JM, Martins ES, Silva JS: Primates of the Ilha de Maracá. The Biodiversity and Enviroment of an Amazonian Rainforest. Edited by: Milliken W, Ratter JA. 1998, John Wiley & Sons LTD, 146-Google Scholar
  3. Cabrera A: Catalogo de los mamíferos de América del Sur. Revista del Museo Argentino de Ciencias Naturales "Bernadino Rivadia" e Instituto Nacional de Investigación de las Ciencias Naturales, Ciencias Zoológicas. 1957, 4 (1): 133-202.Google Scholar
  4. Brumback RA, Staton RD, Benjamin SA, Lang CM: The chromosomes of Aotus trivirgatus Humboldt 1812. Folia Primatologica (Basel). 1971, 15 (3): 264-273. 10.1159/000155384.View ArticleGoogle Scholar
  5. Brumback RA: A third species of the owl monkey (Aotus). Journal of Heredity. 1974, 65 (5): 321-323.PubMedGoogle Scholar
  6. Ma NS, Jones TC, Miller AC, Morgan LM, Adams EA: Chromosome polymorphism and banding patterns in the owl monkey (Aotus). Laboratory Animal Science. 1976, 26 (6 Pt 2): 1022-1036.PubMedGoogle Scholar
  7. Ma NS, Elliott MW, Morgan L, Miller A, Jones TC: Translocation of Y chromosome to an autosome in the Bolivian owl monkey, Aotus. American Journal of Physical Anthropology. 1976, 45 (2): 191-202. 10.1002/ajpa.1330450205.View ArticlePubMedGoogle Scholar
  8. Ma NS, Renquist DM, Hall R, Sehgal PK, Simeone T, Jones TC: XX/"XO" sex determination system in a population of Peruvian owl monkey, Aotus. Journal of Heredity. 1980, 71 (5): 336-342.PubMedGoogle Scholar
  9. Brumback RA: Two distinctive types of owl monkeys (Aotus). Journal of Medical Primatology. 1973, 2 (5): 284-289.PubMedGoogle Scholar
  10. Hershkovitz P: Two new species of night monkeys, genus Aotus (Cebidae, Platyrrhini): A preliminary report on Aotus taxonomy. American Journal of Primatology. 1983, 4 (3): 209-243. 10.1002/ajp.1350040302.View ArticleGoogle Scholar
  11. Ford SM: Taxonomy and distribution of the owl monkey. Aotus: the owl monkey. Edited by: Baer JF, Weller RE, Kakoma I. 1994, San Diego (CA): Academic Press. Inc, 1-57. 1View ArticleGoogle Scholar
  12. Sampaio MIC, Schneider MPC, Barroso CML, Silva BTF, Schneider H, Encarnacion F, Montoya E, Salzano FM: Carbonic anhydrase II in new world monkeys. International Journal of Primatology. 1991, 12 (4): 389-402. 10.1007/BF02547619.View ArticleGoogle Scholar
  13. Ashley MV, Vaughn JL: Owl monkeys (Aotus) are highly divergent in mitochondrial cytochrome C oxidase (COII) sequences. International Journal of Primatology. 1995, 16 (5): 793-806. 10.1007/BF02735720.View ArticleGoogle Scholar
  14. Plautz HL, Goncalves EC, Ferrari SF, Schneider MP, Silva A: Evolutionary inferences on the diversity of the genus Aotus (Platyrrhini, Cebidae) from mitochondrial cytochrome C oxidase subunit II gene sequences. Molecular Phylogenetics and Evolution. 2009, 51 (2): 382-387. 10.1016/j.ympev.2009.01.005.View ArticlePubMedGoogle Scholar
  15. Defler TR, Bueno ML: Aotus Diversity and the Species Problem. Primate Conservation. 2007, 55-70. 10.1896/052.022.0104. 22Google Scholar
  16. Collins WE, Anders RF, Pappaioanou M, Campbell GH, Brown GV, Kemp DJ, Coppel RL, Skinner JC, Andrysiak PM, Favaloro JM, et al: Immunization of Aotus monkeys with recombinant proteins of an erythrocyte surface antigen of Plasmodium falciparum. Nature. 1986, 323 (6085): 259-262. 10.1038/323259a0.View ArticlePubMedGoogle Scholar
  17. Carvalho LJ, Oliveira SG, Alves FA, Brigido MC, Muniz JA, Daniel-Ribeiro CT: Aotus infulatus monkey is susceptible to Plasmodium falciparum infection and may constitute an alternative experimental model for malaria. Memorias do Instituto Oswaldo Cruz. 2000, 95 (3): 363-365.View ArticlePubMedGoogle Scholar
  18. Wong SK, Connole M, Sullivan JS, Choe H, Carville A, Farzan M: A New World primate deficient in tetherin-mediated restriction of human immunodeficiency virus type 1. Journal of Virology. 2009, 83 (17): 8771-8780. 10.1128/JVI.00112-09.PubMed CentralView ArticlePubMedGoogle Scholar
  19. Neil SJ, Zang T, Bieniasz PD: Tetherin inhibits retrovirus release and is antagonized by HIV-1 Vpu. Nature. 2008, 451 (7177): 425-430. 10.1038/nature06553.View ArticlePubMedGoogle Scholar
  20. Ribeiro IP, Menezes AN, Moreira MA, Bonvicino CR, Seuánez HN, Soares MA: Evolution of Cyclophilin α and TRIMCyp retrotransposition in New World primates. Journal of Virology. 2005, 79 (23): 14998-15003. 10.1128/JVI.79.23.14998-15003.2005.PubMed CentralView ArticlePubMedGoogle Scholar
  21. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory Course Manual. 1989, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory PressGoogle Scholar
  22. Irwin DM, Kocher TD, Wilson AC: Evolution of the cytochrome b gene of mammals. Journal of Molecular Evolution. 1991, 32 (2): 128-144. 10.1007/BF02515385.View ArticlePubMedGoogle Scholar
  23. Bonvicino CR, Lemos B, Seuánez HN: Molecular phylogenetics of howler monkeys (Alouatta, Platyrrhini). A comparison with karyotypic data. Chromosoma. 2001, 110 (3): 241-246. 10.1007/s004120000128.View ArticlePubMedGoogle Scholar
  24. Nascimento FF, Bonvicino CR, de Oliveira MM, Schneider MP, Seuánez HN: Population genetic studies of Alouatta belzebul from the Amazonian and Atlantic Forests. American Journal of Primatology. 2007, 70 (5): 423-431. 10.1002/ajp.20507.View ArticlePubMedGoogle Scholar
  25. Moreira MA: SRY evolution in Cebidae (Platyrrhini: Primates). Journal of Molecular Evolution. 2002, 55 (1): 92-103. 10.1007/s00239-001-2308-7.View ArticlePubMedGoogle Scholar
  26. Whitfield LS, Lovell-Badge R, Goodfellow PN: Rapid sequence evolution of the mammalian sex-determining gene SRY. Nature. 1993, 364 (6439): 713-715. 10.1038/364713a0.View ArticlePubMedGoogle Scholar
  27. MacCarthy C: Chromas. 1998, Southport, Queensland, Australia: School of Health Science, Griffith University, Gold Coast Campus, 1.45 (32-bit)Google Scholar
  28. Hall T: Bioedit. 2007, Carlsbad, CA: Ibis Biosciences, 7.0.9Google Scholar
  29. Eyre TA, Ducluzeau F, Sneddon TP, Povey S, Bruford EA, Lush MJ: The HUGO Gene Nomenclature Database, 2006 updates. Nucleic Acids Research. 2006, 34: D319-321. 10.1093/nar/gkj147.PubMed CentralView ArticlePubMedGoogle Scholar
  30. HGNC: HGNC Database, HUGO Gene Nomenclature Committee (HGNC). 2009, EMBL Outstation - Hinxton, European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SD, UKGoogle Scholar
  31. Farris JS, Kallersjo M, Kluge AG, Bult C: Testing the significance of congruence. Cladistics. 1994, 10 (3): 315-319. 10.1111/j.1096-0031.1994.tb00181.x.View ArticleGoogle Scholar
  32. Swofford DL: PAUP*. Phylogenetic analysis using parsimony (*and other methods). 2002, Sunderland, Massachusetts: Sinauer Associates, 4.0b10Google Scholar
  33. Akaike H: Information theory and an extension of the maximum likelihood principle. Second International Symposium on Information Theory. 1973, Akademia Kiado, 267-281.Google Scholar
  34. Posada D, Crandall KA: Selecting the best-fit model of nucleotide substitution. Systematic Biology. 2001, 50 (4): 580-601. 10.1080/106351501750435121.View ArticlePubMedGoogle Scholar
  35. Schwarz G: Estimating the dimension of a model. Annals of Statistics. 1978, 6 (2): 461-464. 10.1214/aos/1176344136.View ArticleGoogle Scholar
  36. Keane TM, Creevey CJ, Pentony MM, Naughton TJ, McLnerney JO: Assessment of methods for amino acid matrix selection and their use on empirical data shows that ad hoc assumptions for choice of matrix are not justified. BMC Evolutionary Biology. 2006, 6: 29-10.1186/1471-2148-6-29.PubMed CentralView ArticlePubMedGoogle Scholar
  37. Yang Z: PAML 4: Phylogenetic Analysis by Maximum Likelihood. Molecular Biology and Evolution. 2007, 24 (8): 1586-1591. 10.1093/molbev/msm088.View ArticlePubMedGoogle Scholar
  38. Zwickl DJ: Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. 2006, Austin: The University of TexasGoogle Scholar
  39. Ronquist F, Huelsenbeck JP: MrBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003, 19 (12): 1572-1574. 10.1093/bioinformatics/btg180.View ArticlePubMedGoogle Scholar
  40. Drummond AJ, Rambaut A: BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology. 2007, 7: 214-10.1186/1471-2148-7-214.PubMed CentralView ArticlePubMedGoogle Scholar
  41. Drummond AJ, Ho SY, Phillips MJ, Rambaut A: Relaxed phylogenetics and dating with confidence. PLoS Biology. 2006, 4 (5): e88-10.1371/journal.pbio.0040088.PubMed CentralView ArticlePubMedGoogle Scholar
  42. Opazo JC, Wildman DE, Prychitko T, Johnson RM, Goodman M: Phylogenetic relationships and divergence times among New World monkeys (Platyrrhini, Primates). Molecular Phylogenetics and Evolution. 2006, 40 (1): 274-280. 10.1016/j.ympev.2005.11.015.View ArticlePubMedGoogle Scholar
  43. Rambaut A, Drummond AJ: 2007, Tracer v1.4, []
  44. Tamura K, Dudley J, Nei M, Kumar S: MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution. 2007, 24 (8): 1596-1599. 10.1093/molbev/msm092.View ArticlePubMedGoogle Scholar
  45. Guindon S, Gascuel O: A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology. 2003, 52 (5): 696-704. 10.1080/10635150390235520.View ArticlePubMedGoogle Scholar
  46. Hasegawa M, Kishino H, Yano T: Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution. 1985, 22 (2): 160-174. 10.1007/BF02101694.View ArticlePubMedGoogle Scholar
  47. Kimura M: A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution. 1980, 16 (2): 111-120. 10.1007/BF01731581.View ArticlePubMedGoogle Scholar
  48. Shimodaira H, Hasegawa M: Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Molecular Biology and Evolution. 1999, 16 (8): 1114-1116.View ArticleGoogle Scholar
  49. Yang Z, Nielsen R, Hasegawa M: Models of amino acid substitution and applications to mitochondrial protein evolution. Molecular Biology and Evolution. 1998, 15 (12): 1600-1611.View ArticlePubMedGoogle Scholar
  50. Jones DT, Taylor WR, Thornton JM: The rapid generation of mutation data matrices from protein sequences. Computer Applications in the Biosciences. 1992, 8 (3): 275-282.PubMedGoogle Scholar
  51. Stanyon R, Bigoni F, Slaby T, Muller S, Stone G, Bonvicino CR, Neusser M, Seuánez HN: Multi-directional chromosome painting maps homologies between species belonging to three genera of New World monkeys and humans. Chromosoma. 2004, 113 (6): 305-315. 10.1007/s00412-004-0320-6.View ArticlePubMedGoogle Scholar
  52. Torres OM, Enciso S, Ruiz F, Silva E, Yunis I: Chromosome diversity of the genus Aotus from Colombia. American Journal of Primatology. 1998, 44 (4): 255-275. 10.1002/(SICI)1098-2345(1998)44:4<255::AID-AJP2>3.0.CO;2-V.View ArticlePubMedGoogle Scholar
  53. Santos-Mello R, Mello MT: Cariótipo de Aotus trivirgatus (macaco-da-noite) das proximidades de Manaus, Amazonas. Nota preliminar. A Primatologia no Brasil. Edited by: Mello MT. 1986, Belo Horizonte: Imprensa Universitária, Universidade Federal de Minas Gerais, 2: 139-146.Google Scholar
  54. Pieczarka JC, Nagamachi CY: Cytogenetic studies of Aotus from eastern Amazonia: Y/Autosome rearrangement. American Journal of Primatology. 1988, 14 (3): 255-263. 10.1002/ajp.1350140306.View ArticleGoogle Scholar
  55. Groves C: Order Primates. Mammal Species of the World A Taxonomic and Geographic Reference. Edited by: Wilson DE, Reeder DM. 2005, Baltimore: Johns Hopkins University Press, 111-184. 3Google Scholar
  56. Silva JS, Fernandes MEB: A Northeastern Extension of the Distribution of Aotus infulatus in Maranhão, Brazil. Neotropical Primates. 1999, 7 (3): 76-80.Google Scholar
  57. Silva JS, Silva CR, Kasecker TP: Primatas do Amapá. 2008, Bogotá: Panamericana Editorial LtdaGoogle Scholar
  58. Elliot DG: A Review of the Primates. 1913, New York: American Museum of Natural History, 1:Google Scholar
  59. Spix von JB: Simiarum et Vespertilionum Brasiliensium species novae. 1823, Monachii: F.S. HubschmannGoogle Scholar
  60. Ma NSF: Chromosome evolution in the owl monkey, Aotus. American Journal of Physical Anthropology. 1981, 54 (3): 293-303. 10.1002/ajpa.1330540302.View ArticleGoogle Scholar
  61. Lorenz JG, Jackson WE, Beck JC, Hanner R: The problems and promise of DNA barcodes for species diagnosis of primate biomaterials. Philosophical Transactions of the Royal Society B: Biological Sciences. 2005, 360 (1462): 1869-1877. 10.1098/rstb.2005.1718.View ArticleGoogle Scholar
  62. Lavergne A, Catzeflis F, Lacote S, Barnaud A, Bordier M, Mercereau-Puijalon O, Contamin H: Genetic analysis of the Saimiri breeding colony of the Pasteur Institute (French Guiana): development of a molecular typing method using a combination of nuclear and mitochondrial DNA markers. Journal of Medical Primatology. 2003, 32 (6): 330-340. 10.1046/j.1600-0684.2003.00038.x.View ArticlePubMedGoogle Scholar
  63. Ascunce MS, Hasson E, Mudry MD: Description of the cytochrome C oxidase subunit II gene in some genera of New World monkeys (Primates, Platyrrhini). Genetica. 2002, 114 (3): 253-267. 10.1023/A:1016230421820.View ArticlePubMedGoogle Scholar

