Skip to main content

Table 1 Primers used in the study. F, forward; R, reverse.

From: Ancient origin of a Western Mediterranean radiation of subterranean beetles

Gene Name Sense Sequence Reference
cox1 Jerry (M202) F CAACATTTATTTTGATTTTTTGG [72]
  Pat (M70) R TCCA(A)TGCACTAATCTGCCATATTA [72]
  Chy F T(A/T)GTAGCCCA(T/C)TTTCATTA(T/C)GT A. Cieslak, this work
  Tom R AC(A/G)TAATGAAA(A/G)TGGGCTAC(T/A)A A. Cieslak, this work
  Tom-2 R A(A/G)GGGAATCATTGAATAAA(A/T)CC A. Cieslak, this work
cob CB3 F GAGGAGCAACTGTAATTACTAA [73]
  CB4 R AAAAGAAA(AG)TATCATTCAGGTTGAAT [73]
rrnL-nad1 16saR (M14) F CGCCTGTTTA(A/T)CAAAAACAT [72]
  16Sa R ATGTTTTTGTTAAACAGGCG [72]
  16Sb R CCGGTCTGAACTCAGATCATGT [72]
  16SAlf1 R GCATCACAAAAAGGCTGAGG [74]
  ND1A (M223) R GGTCCCTTACGAATTTGAATATATCCT [72]
  16Sbi F ACATGATCTGAGTTCAAACCGG [72]
  FawND1 R TAGAATTAGAAGATCAACCAGC [72]
SSU 5' F GACAACCTGGTTGATCCTGCCAGT [32]
  b5.0 R TAACCGCAACAACTTTAAT [32]
LSU Ka F ACACGGACCAAGGAGTCTAGCATG NHM (2000)
  Kb R CGTCCTGCTGTCTTAAGTTAC NHM (2000)