Skip to main content

Table 2 Primers used in the present study

From: Towards resolving Lamiales relationships: insights from rapidly evolving chloroplast sequences

Name Sequence 5'-3' Design
trnK3914Fdi GGGGTTGCTAACTCAACGG Johnson and Soltis [120]
LE1R ATAGAAATAGATTCGTTC Müller et al. [13]
LE4R TTCGCCTGAAAATCCGTAACC Müller et al. [13]
LE5R CAAGGTTCCTTGCRCCAACC this study
ACmatK500F TTCTTCTTTGCATTTATTACG Müller and Borsch [121]
LindmatK1714R CTCCAAAGAAAGYCAGTTCCTCTT this study
LindmatK1580F TCAATTCATTCAACWTTTCCC this study
LE2F TGGTACGGAGTCAAAKTC Müller et al. [13]
trnK2R AACTAGTCGGATGGAGTAG Johnson and Soltis [120]
trntC2 TATGGCGAAATTGGTAGACGC this study
trntF ATTTGAACTGGTGACACGAG Taberlet et al. [122]
rpsF GTGTGTAGAAAGCAACGTGCGACTT Oxelman et al. [123]
rpsR2 TCGGGATCGAACATCAATTGCAAC Oxelman et al. [123]