Skip to main content

Table 4 Oligonucleotides used for site-directed mutagenesis, allele-specific PCR and quantitative PCR

From: Positive selection at high temperature reduces gene transcription in the bacteriophage ϕX174

Primer Name Location* Sequence (5' to 3') Purpose
2605F 2605-2626 CAGGTTGTTTCTGTTGGTGCTG Amplification
2953R 2937-2953 CCGCCAGCAATAGCACC Amplification
Anc_asF 305-324 GTAGAGATTCTCTTGTTGAC Allele-specific
mut323_asF 305-323 GTAGAGATTCTCTTGTTGG Allele-specific
mut324_asF 304-324 GGTAGAGATTCTCTTGTTGAT Allele-specific
phiXpD_asR 625-603 GCAATAAACTCAACAGGAGCAGG Amplification
  1. * Based upon Sanger, et al. sequence [24].
  2. ** Mutation underlined