Skip to main content

Advertisement

Table 4 Oligonucleotides used for site-directed mutagenesis, allele-specific PCR and quantitative PCR

From: Positive selection at high temperature reduces gene transcription in the bacteriophage ϕX174

Primer Name Location* Sequence (5' to 3') Purpose
319F 314-338 CTCTTTTTGACATTTTAAAAGAGCG** Mutagenesis
319R 338-314 CGCTCTTTTAAAATGTCAAAAAGAG Mutagenesis
321F 314-338 CTCTTGTCGACATTTTAAAAGAGCG Mutagenesis
321R 338-314 CGCTCTTTTAAAATGTCGACAAGAG Mutagenesis
323F 314-338 CTCTTGTTGGCATTTTAAAAGAGCG Mutagenesis
323R 338-314 CGCTCTTTTAAAATGCCAACAAGAG Mutagenesis
324F 314-338 CTCTTGTTGATATTTTAAAAGAGCG Mutagenesis
324R 338-314 CGCTCTTTTAAAATATCAACAAGAG Mutagenesis
2605F 2605-2626 CAGGTTGTTTCTGTTGGTGCTG Amplification
2953R 2937-2953 CCGCCAGCAATAGCACC Amplification
Anc_asF 305-324 GTAGAGATTCTCTTGTTGAC Allele-specific
mut323_asF 305-323 GTAGAGATTCTCTTGTTGG Allele-specific
mut324_asF 304-324 GGTAGAGATTCTCTTGTTGAT Allele-specific
phiXpD_asR 625-603 GCAATAAACTCAACAGGAGCAGG Amplification
phiXpB_F 5337-5360 CTCAAATTTATGCGCGCTTCGATA qPCR Primer
phiXpB_M 5377-7 CCAACCTGCAGAGTTT qPCR Probe
phiXpB_R 27-7 TTCTGCGTCATGGAAGCGATA qPCR Primer
phiXpD_F 400-424 TTACTGAACAATCCGTACGTTTCCA qPCR Primer
phiXpD_M 427-443 CCGCTTTGGCCTCTATT qPCR Probe
phiXpD_R 466-457 ACGGCAGAAGCCTGAATGAG qPCR Primer
  1. * Based upon Sanger, et al. sequence [24].
  2. ** Mutation underlined