Skip to main content

Advertisement

Table 3 Standard set of 24 short PCR primer pairs for lophiiforms

From: Evolutionary history of anglerfishes (Teleostei: Lophiiformes): a mitogenomic perspective

No. Primer a Sequence (5' to 3') Reference
1 L1083-12S ACAAACTGGGATTAGATAC [47]
  H2590-16S ACAAGTGATTGCGCTACCTT [47]
2 L2949-16S GGGATAACAGCGCAATC [47]
  H3976-ND1 ATGTTGGCGTATTCKGCKAGGAA [43]
3 L2949-16S GGGATAACAGCGCAATC [47]
  H4432-Met TTTAACCGWCATGTTCGGGGTATG [46]
4 L4299-Ile AAGGRCCACTTTGATAGAGT This study
  H5669-Asn AACTGAGAGTTTGWAGGATCGAGGCC [53]
5 L4633-ND2 CACCACCCWCGAGCAGTTGA [47]
  H5669-Asn AACTGAGAGTTTGWAGGATCGAGGCC [53]
6 L5549-Trp AAGACCAGGAGCCTTCAAAG This study
  H6558-CO1 CCKCCWGCKGGGTCAAAGAA [53]
7 L6205-CO1 TTCCCWCGAATAAATAACATAAG [87]
  H7447-Ser AWGGGGGTTCRATTCCTYCCTTTCTC [87]
8 L7255-CO1 GATGCCTACACMCTGTGAAA [47]
  H8312-Lys CACCWGTTTTTGGCTTAAAAGGCTAAYGCT [87]
9 L8202-CO2 TGYGGAGCWAATCAYAGCTT [87]
  H9375-CO3 CGGATRATGTCTCGTCATCA [53]
10 L8343-Lys AGCGTTGGCCTTTTAAGCTAAWGATWGGTG [87]
  H9639-CO3 CTGTGGTGAGCYCAKGT [47]
11 L8343-Lys AGCGTTGGCCTTTTAAGCTAAWGATWGGTG [87]
  H10019-Gly CAAGACKGKGTGATTGGAAG [47]
12 L8343-Lys AGCGTTGGCCTTTTAAGCTAAWGATWGGTG [87]
  H10433-Arg AACCATGGWTTTTTGAGCCGAAAT [47]
13 L10054-Gly CACCWGGTCTTGGTTWAAMTCCMAGGAAAG This study
  H11534-ND4M GCTAGKGTAATAAWKGGGTA [87]
14 L10440-Arg AAGATTWTTGATTTCGGCT [27]
  H11534-ND4M GCTAGKGTAATAAWKGGGTA [87]
15 L11424-ND4 TGACTTCCWAAAGCCCATGTAGA [47]
  H12632-ND5 GATCAGGTTACGTAKAGKGC [47]
16 L12329-Leu CTCTTGGTGCAAMTCCAAGT [47]
  H13396-ND5 CCTATTTTTCGGATGTCTTG [53]
17 L12329-Leu CTCTTGGTGCAAMTCCAAGT [47]
  H13727-ND5 GCGATKATGCTTCCTCAGGC [47]
18 L13553-ND5 AACACMTCTTAYCTWAACGC [53]
  H14768-CYB TTKGCGATTTTWAGKAGGGGGTG [87]
19 L13553-ND5 AACACMTCTTAYCTWAACGC [53]
  H15149-CYB GGTGGCKCCTCAGAAGGACATTTGKCCTCA [53]
20 L14504-ND6 GCCAAWGCTGCWGAATAMGCAAA [53]
  H15560-CYB TAGGCRAATAGGAARTATCA [47]
21 L14718-Glu TTTTTGTAGTTGAATWACAACGGT This study
  H15913-Thr CCGGTSTTCGGMTTACAAGACCG [87]
22 L15369-CYB ACAGGMTCAAAYAACCC [53]
  H16484-CR GAGCCAAATGCMAGGAATARWTCA [87]
23 L15998-Pro AACTCTTACCMTTGGCTCCCAARGC [53]
  H885-12S TAACCGCGGYGGCTGGCACGA [87]
24 L16507-CR TGAWYTATTCCTGGCATTTGGYTC [87]
  H1358-12S CGACGGCGGTATATAGGC [47]
  1. a L and H denote light and heavy strands, respectively. Positions with mixed bases are labeled with their IUB codes