Skip to main content

Table 2 The primer sequences used for the 12 EPIC markers.

From: Exon-primed intron-crossing (EPIC) markers for non-model teleost fishes

Locus Forward primer sequence Reverse primer sequence
59107E2 GGAGATGGGYGTGGACTGGTCYCT ATTGTAGATCTCVTCCACCACCTGRAT
55378E1 ATGARGAAAATGAGGCCAACTTGCT GCCACCTGKGTATTGATTATAGCTGAG
55305E1 CCTAGTGGACTGTARTAACGCCCCYCT AAGCCATCCAGTTTGCATAAACACTATC
40245E5 CTGAGGAGGAYGGCTGGGARTTYGT ACCATCAGCTTCACCACCTGCTC
36298E1 GATCCTGAGGGAYTCCCAYGGTGT GGGCCAGGACTCTCYTGGTCTTGTAGT
25073E1 GTACTCTCKGTACATGTTGTGRGTKCC GAAGGTGAARAACTTTGGBATCTGG
19231E4 CGGARGACTACGGACGTGATTTGAC CTCCYTCCAGTGSTCCACAAACT
14867E1 CCACAARTACAAGGCCAAGAGRAACTG GTTCTCCTTSTCCTGSACGGTCTT
8680E3 GGAGGAGARTTYAAGAAGTAYCTGGACAT CSCCCTTCAGGCCCTGGATGAT
8680E2 GATATGGTGGAYTACCTGAACGASCTG TCCTCAGCKATGTGGTGRATGAA
4174E20 CTYTCGCTGGCTTTGTCTCAAATCA CTTTTACCATCKCCACTRAAATCCAC
1777E4 AGGAGYTGGTGAACCAGAGCAAAGC AGATCRGCCTGAATSAGCCAGTT