Skip to main content

Advertisement

Table 1 Primer sequences.

From: Diversification of CYCLOIDEA-like genes in Dipsacaceae (Dipsacales): implications for the evolution of capitulum inflorescences

CYCcopy Name 5' to 3'
Forward primer   
CYC1 CYC1F GACATKCTBGGATTCGARAAGGC
CYC2A CYC2AF AAAGATTTGGTMMDRTCCAATCT
CYC2Ba CYC2BaF GGTATACCCCATTTTCACATCTTAC
CYC2Bb CYC2BbF GTATACCCCATTTTCACATCTTACATCA
CYC3A CYC3A ATACATATGTATCCTTTAGCCAATACA
CYC3B CYC3BF GAAACATTTACCTGCAACCCA
Reverse primer   
CYC1 CYC1R GCTCTTTCTCTYGCYTTYGCCCT
CYC2A CYC2AR CGYGTGTTGYTACCGATCTCC
CYC2Ba &CYC2Bb CYC2R TCTTGCTCTTTCYCTYGCYTTYGCCCTA
CYC3A &CYC3B CYC3R TGCTCTTTCTCTCGCYTTCGCCCTAGC
  1. Primer sequences used in this study.