Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 3 Targeted regions, primer sequences and approximate product length (bp) of PCR for primer pairs used to amplify six cpDNA regions of Norway spruce

From: Population dynamics and genetic changes of Picea abies in the South Carpathians revealed by pollen and ancient DNA analyses

Region (short name) cpDNA region Primer Sequence (5' - 3') Position in cpDNA of Pinus thunbergiiNC_001631 Position in cpDNA of Picea sitchensisNC_011152 Fragment Length in P. abies(bp)
ndhCp-ndhKp (CK) pseudogene ndhK-for1 CACTTCAGTTCTTGTTGTTCC 66530→66550 66774→66794 136 bp
   ndhC_ndhK-rev TCGCCACAGAACCAACGATG 66666→66647 66910→66891  
psbM-trnD (MD) intergene spacer psbM_trnD-f1 GTTCGAGTAACGGAATCTAAC 28004→28024 27925→27945 200 bp
   psbM_trnD-rev1 CGAACGTCTTCTGGAGTAGC 28204→28185 28124→28105  
Pt3024, ORF46b* (B) microsatellite B-for GCTTATGGCATTGTTGATGT 30166→30185 30701→30720 212-216 bp
   B-rev TGGGCATTCTAGCTGTATTG 30387→30368 30941→30922  
Pt15169, ORF84* (D) microsatellite D-for CTTGGATGGAATAGCAGCC 15169→15187 15208→15226 124 bp
   D-rev GGAAGCGCATTAAGGTCATTA 15286→15266 15327→15307  
trnT-trnL (TL) intergene spacer trnT_trnL-sp-f1 CTGAGCTAAGCAGGCTCAATGG 69189→69168 69573→69552 251 bp
   trnT_trnL-sp-brev GCATGTTATTATCCTCCCCTAG 68945→68967 69323→69344  
trnL (Li) Intron trnL-intron-f2 GAACGCTCTATTTACACC 68497→68480 68884→68867 237 bp
   trnL-intron-rev ACACGTAGAATTGGACTCTATC 68261→68282 68648→68669  
trnL-trnF (LF) Intergene spacer Aa_trnLF-for GGTTCAAGTCCCTCTATCCC 68198→68179 ? 186 bp
   Aa_trnLF-rev ACTGATCAACTCAACTTGTCATAAGATGG 68014→68042 68400→68428  
matK-trnK (K2i) intron trnK2i-f1 GCCCTCGTTCATGAGAATAACC 3281→3302 3368→3389 204 bp
   trnK2i-r1 CATGAGTCAGGAGAGCGATTGG 3477→3456 3573→3552  
  1. * cpDNA region names from Parducci et al. (2005); primers B and D are from Parducci et al. (2005); primers CK, MD, TL, Li, LF and K2i were designed specifically for this study