Skip to main content

Advertisement

Table 4 Locus information and list of the primers used in this study

From: Demographic histories of adaptively diverged riparian and non-riparian species of Ainsliaea(Asteraceae) inferred from coalescent analyses using multiple nuclear loci

Locus Best BLAST hit E-value Species Gene Primer name Sequences 5'-3' Primer source
GA2ox1 AB031206 1.00E-104 Lactuca sativa gibberellin 2-oxidase 1 GA2ox1 Ai2 F GACCAAGCGTGATTTACTCTG Developed for this study
GA2ox1 R TTCTCGCTCAATGGTGGTCCT Developed for this study
CHS X91343 8.00E-11 Leibnitzia anandria chalcone synthase 1266 F ATCACCCACCTCATCTTCTGCAC Álvarez et al.[40]
1990 R TCCAAAAGATCGAGTTCCAGTC Álvarez et al.[40]
GTF AB070746 5.00E-06 Vigna angularis glucosyltransferase-3 GTF F ACCAGATGCACCCTATTCATCT Developed for this study
GTF R AAAGCGTGGTGGTGCTGATT Developed for this study
CPPS1 AF034545 1.00E-32 Stevia rebaudiana copalyl pyrophosphate synthase (Cpps1) CPPS1 F GAKGGAGAGATAACTGTATC Developed for this study
CPPS1 R GGKTYCGTCTTGCATAGATT Developed for this study
A25 EF519751 1.00E-18 Carthamus oxyacanthus Unknown A25 F TTGCATGSTCTTATCAGTCC Chapman et al.[41]
A25 R GAAGABCCCATCCARCAGAAGAG Chapman et al.[41]
A27 EF519770 4.00E-11 Carthamus oxyacanthus Unknown A27 F CTTGCAWTGAATGTCATGTGGAAG Chapman et al.[41]
A27 R GCTCCCCARCATTTCA Chapman et al.[41]
B12 EF519836 3.00E-68 Carthamus lanatus Unknown B12 F CAAGTGGCTGCAGCCATGGG Chapman et al.[41]
B12 R ACATCRGGMACCATTCCWCCGGTGT Chapman et al.[41]
D10 HM640003 5.00E-15 Medicago truncatula somatic embryogenesis receptor kinase 5 (SERK5) D10 F GATTGCTYGTTTATCCCTACATGG Chapman et al.[41]
D10 R ATATTTGCAGCTTTCACATC Chapman et al.[41]
D13 No hit - - Unknown D13 F ATGTCAGGTTTTGGRCAYCGTGT Chapman et al.[41]
D13 R CCAGARTAGAAATCAACATTYGGGTAC Chapman et al.[41]
D22 EF484030 5.00E-19 Carthamus tinctorius Unknown D22 F CGHAGAACTCCAGCTGAA Chapman et al.[41]
      D22 R GCTTCTTCTTGCCTGATGCT Chapman et al.[41]