Skip to main content

Advertisement

Table 2 Primers used for semi quantitative (RT-PCR) and real-time PCR (qPCR) of teleost-specific tlr s in Atlantic cod

From: Diversification of the expanded teleost-specific toll-like receptor family in Atlantic cod, Gadus morhua

Gene Name qPCR primer (Forward and Reverse) (5-3) Amplicon (bp) RT-PCR/qPCR annealing (°C) Efficiency (%)
tlr21 CGTTACAATCGCATCCTCTCAG GCTGCTCCACAACTCAGTCAAG 177 58/60 110
tlr22a GCAGGAAGTTCTGGAGACATTTA TCATTCACATTGGAGCACAAGTG 186 58/60 98
tlr22b GAGTTGGACTTTGGGACGAA ACATTCCTGACGGCACAAG 128 58/60 125
tlr22c TCAGTTCCCAATGCCGTAAG ACACAGTCCTTTAGAACCAAGACAC 155 58/62 130
tlr22d AGAGGAGGGTATGTTTGATGGC TGTTCGCTAAGTTCCGCAGTT 152 58/62 116
tlr22e CCAACCTCACAAGATTGAACCT GCAAGCGACAACCACTGATA 120 58/60 115
tlr22f CGCTTAGACCTGAGACACAACTT AATCCATCAAACATACCCTCCTC 131 58/64 91
tlr22g GCAGCAAACGAGATGTCCAC TCTCCCAGACGATACCATTCTC 178 58/64 116
tlr22h GCTTAGACCTGACACGCAACA AAGCCAGACGCAGTTCAATG 159 58/62 130
tlr22i GCATCGGTAGAGCCTATTCTGA GAAATTGGTCCGCTTATGAGA 102 58/64 111
tlr22j TGTGATTAGAGAACCAGTGATGCT TGTGTCTGCTTGTTTGTGATTACC 129 58/62 92
tlr22k TCCTACAATGGCAACTGGTCTAC CCCAGCCCTCGTCGTTTG 129 58/60 88
tlr22l CTCTTAGGCTGCTTAACACTTTAATC TGGATAGATAGATAACGCTGAGACG 171 58/60 104
tlr23a CCTTCGGCTACCACTTCCTG GCCTCGCTCGTCCTCCA 188 58/62 110
tlr23b GACTCCAATTTCCTCTGCTTCA GGTGCTGCTCATTATTCTTCCT 163 58/64 94
luciferase TCATTCTTCGCCAAAAGCACTCTG AGCCCATATCCTTGTCGTATCCC 149 58/58 98
eef1a CACTGAGGTGAAGTCCGTTG GGGGTCGTTCTTGCTGTCT 142 58/58 110
ubi GGCCGCAAAGATGCAGAT CTGGGCTCGACCTCAAGAGT 69 69/60 92