Skip to main content

Advertisement

Table 1 Primers used in this study

From: Conquering the Sahara and Arabian deserts: systematics and biogeography of Stenodactylus geckos (Reptilia: Gekkonidae)

Gene fragment Primer name Or.1 Sequence (5′- 3′) Reference PCR conditions
12S 12Sa F AAACTGGGATTAGATACCCCACTAT Kocher et al. (1989) 94º (5'); 94º (45"), 51º (45"), 72º (80") × 35; 72 (5')
12Sb R GAGGGTGACGGGCGGTGTGT Kocher et al. (1989)
L1.STENO F GGATTAGATACCCCACTATGC This study 94º (5'); 94º (45"), 52º (45")’, 72º (90") × 35; 72º (5')
H1.STENO1 R TGACGGGCGGTGTGTACG This study  
16S 16Sa F CGCCTGTTTATCAAAAACAT Palumbi (1996) 94º (5'); 94º (45"), 51 (45"), 72 (80") × 35; 72º (5')
16Sb R CCGGTCTGAACTCAGATCACGT Palumbi (1996)  
16SaST F ATCAAAAACATCGCCTTTAGC This study 94º (5'); 94º (45"), 57º (45"), 72º (70") × 35; 72º (5')
16SbST R CTGAACTCAGATCACGTAGGAC This study  
C- mos FUF F TTTGGTTCKGTCTACAAGGCTAC Gamble et al. (2008) 94º (5'); 94º (30"), 55º (45"), 72º (70") × 35; 72º (10')
FUR R AGGGAACATCCAAAGTCTCCAAT Gamble et al. (2008)  
G73_STENO F GCTGTAAAGCAGGTGAAGAAATGC This study 94º (5'); 94º (45"), 56º (45"), 72º (80") × 35; 72º (5')
G74_STENO R GAACATCCAAAGTCTCCAATCTTGC This study  
G73.5_STENO F GCATTTGGACTTAAAACCTG This study  
G708 R GCTACATCAGCTCTCCARCA Hugall et al. (2008)  
RAG -2 RAG2-PY1-F F CCCTGAGTTTGGATGCTGTACTT Gamble et al. (2008) 94º (5'); 94º (45"), 55º (45"), 72º (70") × 35; 72º (5')
RAG2-PY1-R R AACTGCCTRTTGTCCCCTGGTAT Gamble et al. (2008)
  1. List of primers used in the amplification and sequencing of gene fragments, with the corresponding source and PCR conditions.
  2. 1Orientation.