Skip to main content

Advertisement

Table 3 Information for the 18 Y-SNP markers and primer sequences

From: Y Chromosome analysis of prehistoric human populations in the West Liao River Valley, Northeast China

Marker Amplicon size (bp) PCR primer sequnces (5’→3’) Test method
   Forward Reverse  
C/M216 109bp TCACTTTTATATCCTCAACCA AATCTGAATTCTGACACTGC Sequence
C3/M217 101bp ACTTGTGAAGGAGAATGAAAA GCATTTGATAAAGCTGCTGTG Sequence
C3c/M48 140bp AAACAATATGTATGCTAATTTTGCT TCAATGTAAATGTTAGTATAAGGATG Sequence
C3d/M407 114bp TCTTACTGAAAGTTGGGGAC GATAATCGCTTGTCTCTTGG Sequence
C3e/P53.1 123bp/121bp AAACCCTGGAGAGGACCAACGA ACACTATGAACCAATCCCACCC Sequence
F/M89 125bp CCACAGAAGGATGCTGCTCA CACACTTGGGTCCAGGATCAC Sequence
K/M9 128bp GGACCCTGAAATACAGAAC AAGCGCTACCTTACTTACAT Sequence
P/M45 129bp GGGTGTGGACTTTACGAAC AAATCCTACTATCTCCTGGC Sequence
NO /M214 119bp MACTGGAAAGAAAAAGAATGCTG ATGGAAATGCCACTTCACTC Sequence
N/M231 113bp CCTGGAAAATGTGGGCTC TTCTTTGACGATCTTTCCCC Sequence
N1a/M128 123bp/121bp ATCTACCTCTTTCAAACTGT GAACTGCCTCTTATAAAATCAT Sequence
N1b/P43 108bp ACGGAGTCTCGCTCTGTCG GCTACTTGGGAGGCTGAGG Sequence
N1c/Tat 115bp GAGAAGGTGCCGTAAAAGTG GGACTCTGAGTGTAGACTTGTG Sequence
O/M175 110bp/105bp TCAACTCAACTCCAGTGATTTA TAATGATACCTTTTTTTCTACTGA PAGE
O3/M122 120bp CAGATACTGTGACTTTGAG GAAATGAATAAATCAAGGT Sequence
O3a/M324 120bp GGAACATAGCAAGACCCAAAAT CAAATTGATTTCCAGGGATACAT Sequence
O3a3/P201 114BP FTAAGCAATGAAGGTAGAAGG ATTTAGAATAATATTTACTGAGCA Sequence
O3a3c/M117 117bp/113bp AAAATAACTCACCAAAGGAAT AGATGATAGAAAAACATAATA PAGE
  1. PAGE: Polyacrylamide gel electrophoresis.