Skip to main content

Advertisement

Table 2 Primers used in the study.

From: Polyphyly of the hawk genera Leucopternis and Buteogallus (Aves, Accipitridae): multiple habitat shifts during the Neotropical buteonine diversification

Target region Primer name Sequence (5'to 3') Reference
12S LPHE1248 AAAGCATGGCACTGAAGAYGCCAAG E. Tavares, unpublished
  12SL1735 GGATTAGATACCCCACTATGC Miyaki et al. [75]
  12SHC CCGCCAAGTCCTTAGAGTTT Eberhard et al. [76]
  12SH2181 GGCTTGTGAGGAGGGTGACGGGC C. Ribas, unpublished
  H2294VAL CTTTCAGGTGTAAGCTGARTGC J. Patane, modified from Sorenson et al. [77]
  16S2- ATCCCTGGGGTAGCTTGGTCC Haring et al. [78]
  16SH3309 TGCGCTACCTTCGCACGGT Miyaki et al. [75]
  H4017 GCTAGGGAGAGGATTTGAACCTC Sorenson et al. [77]
ATP8/6 CO2GQL GGACAATGCTCAGAAATCTGCGG Eberhard and Bermingham [79]
  TLYS9051 CACCAGCACTAGCCTTTTAAG Fleischer et al. [80]
  A6PWL CCTGAACCTGACCATGAAC Eberhard and Bermingham [79]
  CO3HMH CATGGGCTGGGGTCRACTATGTG Eberhard and Bermingham [79]
  ARG11145 TTTGTTGAGCCGAAATCAACTGTCT Present study
ND6 TPROFWD ATCACCAACTCCCAAAGCTGG Riesing et al. [7]
  TGLUREV AAGTTTACAACGGCGATTTTTC Riesing et al. [7]
  YCR2REV GGTTACATGGTTTGGTAGGGG Riesing et al. [7]