Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 5 Primer sequences used to amplify PRP8 intein encoding sequences from euascomycetes.

From: The distribution and evolutionary history of the PRP8 intein

Primer name Relevant species Primer sequence
Aspfum-F1 A. fumigatus, 5' acagatgtcatccaagc 3'
Aspfum-F2 (including 5' tgggaaagagcatgccttgc 3'
Aspfum-F4 Afu. Var. ellipticus 5' gaaccaggaaatggagacg 3'
Aspfum-Rv1 and 5' ttcaacggtatcgtagcg 3'
Aspfum-Rv4 Neosartorya fischeri) 5' acagagtgaaccgacg 3'
Liu_1 Fumigati spp. and 5' atgaagagcaa [tc]cc [agct]tt [tc]tggtggac 3'
Liu_2 A giganteus 5' gcattcgtgag [tc]tt [ct]tt [ag]aa [tc]ttcat 3'
Ani-Fn A. nidulans 5' agcttgtcttgccaac 3'
Ani-Fs A. nidulans 5' acaaagacagaccaaccaataaacggattg 3'
Ani-Ra A. nidulans 5' actgttatgcagtacaacatag 3'
Ani-Rsn A. nidulans 5' tctcccaggagtctcgacgctaga 3'
Pb_Fwd1 P. brasiliensis 5' catatctctggaactgtggcag 3'
Pb_Fwd2 P. brasiliensis 5' gcagttgggtattgacacagtgc 3'
Pb_Rev1 P. brasiliensis 5' gcactgtgtcaatacccaactgc 3'
Pb_Rev2 P. brasiliensis 5' gcgttcgtcaacttcttgaacttcat 3'
Pb_Rev3 P. brasiliensis 5' gctttgtgctgcctcgttaacg 3'
Para_b-F3 P. brasiliensis 5' gatagaagtcgcacg 3'
Para_b-Rv4 P. brasiliensis 5' gggtcggtttatgc 3'