Skip to main content

Advertisement

Table 2 Primer sequences.

From: Origins of asexuality in Bryobiamites (Acari: Tetranychidae)

Primer Sequence 5' to 3' Reference Position
COI_F1 TGATTTTTTGGTCACCCAGAAG [31] 2173
COI_F2 AAGAGGAGGAGGAGACCCAA [77] 2133
COI_F3 WGTHTTAGCAGGAGCAATTACWAT modified from [78,79] 2067
COI_F4 GGAGGATTTGGAAATTGATTAGTTCC [80] 1693
COI_R1 TACAGCTCCTATAGATAAAAC [31] 2605
COI_R2 AAWCCTCTAAAAATRGCRAATACRGC modified from [77] 2620
28S_D1_F ACCCSCTGAAYTTAAGCAT [81]  
28S_D1_R AACTCTCTCMTTCARAGTTC [81]  
  1. Primers used for amplification and sequencing of part of the COI and 28S D1 region. The position of the COI primers on the COI gene is listed, position numbers correspond to the Drosophila melanogaster mitochondrial DNA sequence [GenBank:U37541]. The fragment between primers F1 and R1 (410 bp) was used for analyses in this study.