Skip to main content

Table 1 Sequences of primers used in the study for the amplification of the four anti-malarial immunity genes. If PCR1 was not succesfull or produced very low signal a nested PCR was applied.

From: The molecular evolution of four anti-malarial immune genes in the Anopheles gambiae species complex

  PCR 1 PCR nested
Gambicin Gamb_exon_313_1505F Gamb_exon_46_692F
     TGAATCCCCTCGGCTCGCTG    CTGAACGCCGTCACAAGTGC
  Gamb_exon_313_1505R Gamb_exon_46_692R
     TGCAGTGAGTTATGTCACAAGC    TGGCACTGATTAAACCGCTTG
NOS NOS _exon_30528F NOS _exon_30705F
     GTGGAYGGAATYATYGAGCG    GGTGTCTACAAATCKGGGA
  NOS _exon_31858R NOS _exon_31692R
     MCGCSYTACTTACCCGCAGCG    CGAKTCCGCCTCYTTGAGGGC
Rel2 Rel2_exon_415F Rel2_exon_504F
     ACACCGTCCTGTCGATGGAC    GGTCGCACCTATGCCAGTGC
  Rel2Frag1Rev Rel2_exon_1275R
     GATGCCCATACCCTGGAAGG    ACACCCTCCGATGGTTCAGC
FBN9 FBN9 _217F FBN9 _264F
     TCCGACCTCCACCGGGTACG    ACTACCTACAGTACAAGCTGCTC
  FBN9 _1149R FBN9 _1075R
     AGCCATGCCCTGGTGCGAGC    GGCAGTTGTTGTACCACCAG