Table 1 Sequences of primers used in the study for the amplification of the four anti-malarial immunity genes. If PCR1 was not succesfull or produced very low signal a nested PCR was applied.
From: The molecular evolution of four anti-malarial immune genes in the Anopheles gambiae species complex
| Â | PCR 1 | PCR nested |
|---|---|---|
Gambicin | Gamb_exon_313_1505F | Gamb_exon_46_692F |
|  |    TGAATCCCCTCGGCTCGCTG |    CTGAACGCCGTCACAAGTGC |
| Â | Gamb_exon_313_1505R | Gamb_exon_46_692R |
|  |    TGCAGTGAGTTATGTCACAAGC |    TGGCACTGATTAAACCGCTTG |
NOS | NOS _exon_30528F | NOS _exon_30705F |
|  |    GTGGAYGGAATYATYGAGCG |    GGTGTCTACAAATCKGGGA |
| Â | NOS _exon_31858R | NOS _exon_31692R |
|  |    MCGCSYTACTTACCCGCAGCG |    CGAKTCCGCCTCYTTGAGGGC |
Rel2 | Rel2_exon_415F | Rel2_exon_504F |
|  |    ACACCGTCCTGTCGATGGAC |    GGTCGCACCTATGCCAGTGC |
| Â | Rel2Frag1Rev | Rel2_exon_1275R |
|  |    GATGCCCATACCCTGGAAGG |    ACACCCTCCGATGGTTCAGC |
FBN9 | FBN9 _217F | FBN9 _264F |
|  |    TCCGACCTCCACCGGGTACG |    ACTACCTACAGTACAAGCTGCTC |
| Â | FBN9 _1149R | FBN9 _1075R |
|  |    AGCCATGCCCTGGTGCGAGC |    GGCAGTTGTTGTACCACCAG |