Skip to main content

Table 3 Primers used for PCR.

From: Molecular phylogeny of ocelloid-bearing dinoflagellates (Warnowiaceae) as inferred from SSU and LSU rDNA sequences

Primer name sequence 5'-3' Target Citation
PF1 GCGCTACCTGGTTGATCCTGCC SSU [56] (modified)
R4 GATCCTTCTGCAGGTTCACCTAC SSU [56] (modified)
D1R ACCCGCTGAATTTAAGCATA LSU [57]
R2 ATTCGGCAGGTGAGTTGTTAC LSU [58]
Euk A AACCTGGTTGATCCTGCCAGT SSU [59] (modified)
Euk B GATCCWTCTGCAGGTTCACCTAC SSU [59]
Dino1662 F CCGATTGAGTGWTCCGGTGAATAA SSU [60]
SR 4 AGGGCAAGTCTGGTGCCAG SSU [61]
SR 9 AACTAAGAACGGCCATGCAC SSU [61]
SR 8 GGATTGACAGATTGAKAGCT SSU [63]
SR 12 CCTTCCGCAGGTTCACCTAC SSU [58]
Dino R TTATTCACCGGAWCACTCAATCGG SSU this manuscript
25 F1 CCGCTGAATTTAAGCATAT LSU [62]
25 R1 CTTGGTCCGTGTTTCAAGAC LSU [61]
LSU D3A GACCCGTCTTGAAACACGGA LSU [63]
LSU R2 ATTCGGCAGGTGAGTTGTTAC LSU [58]
DLSU CTGTTAAAATGAACCAACACCYTTT LSU this manuscript