Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Information on the genes and sequences of the primers used in the study.

From: Evolutionary rate patterns of the Gibberellin pathway genes

Gene Locationa Enzyme Aligned coding length (bp) GC (GC3)b ENCb Primer sequencesc
CPS1 2 ent-copalyl diphosphate synthases I 1002 0.462 (0.494) 54.6 F1: AACTTGTGGAGGTTAGCAG
F2: TGTGGAGGYTAGCRGAGG
R1: AAGTCGCTCAGAGGCACG
R2: TAGCCCATGCAAGTCGCTC
KS1 4 ent-kaurene synthase I 1023 0.426 (0.417) 52.8 F1: TGCTGAAGCTTCCAGTTTCC
F2: TCCAGTTTCCGTGAATCAC
R1: CTTGCACATCTTCCAGAAC
R2: CCTTGACGACTGCATTCAC
KO2 6 ent-kaurene oxidase II 1050 0.514 (0.639) 58.2 F: CTGTAGTTGTGCTCAATTC
R1: GCCATCGTCTTGTACATGTC
R2: TCAGCCTCCACYCGAACTC
KAO 6 ent-kaurenoic acid oxidase 1053 0.603 (0.820) 39.2 F: CAGGACGTTCATGTTCAGCAG
R1: TCGTCGCCAAGCAGTTGTC
R2: GCCAAGCAGTTGTCCAC
GA20ox2 1 GA20-oxidase II 597 0.714 (0.966) 30.1 F: ATCCCGGAGCCATTCGTSTG
R: TGAAGGTGTCGCCGATGTTG
GA3ox2 1 GA3-oxidase II 786 0.710 (0.965) 30.4 F1: ACCCGCTCTRCTTCGACTTC
F2: GGCGGGTGCCGGAGACGCACG
R: CCATGTACTCSGGCCACGTGAC
GA2ox4 5 GA2-oxidase IV 819 0.694 (0.926) 34.0 F: GAGCAGATCTCGCTGSTGAG
R1: CAGGCGGTTGTCGCYGAG
R2: AGGCGGGAGAGGTAGGCAG
Total    6330    
  1. aChromosomal locations in O. sativa.
  2. bAverage of 8 Oryzeae species.
  3. cLocations of the primers for each fragment are showed in Additional file 2. The internal primers were used for cycle sequencing are listed in Additional file 5.