Skip to main content

Advertisement

Table 1 Microsatellite loci assayed from adult Gobiusculus flavescens.

From: Multiple mating and a low incidence of cuckoldry for nest-holding males in the two-spotted goby, Gobiusculus flavescens

Locus Primer sequence (5'-3') Repeat Motif Temp (°C) N A H O H E Excl. prob
2SG-08 F: TGATGGTTCTTCTTTCAATATGC R: GCTGCTGGACACCTGAATTT (GATA)13 58 33 18 0.848 0.908 0.811
2SG-17 F: GCTGCTGGACACCTGAATTT R: CGATCGCCTTTCAGTTTGAC (CTAT)11 56 33 15 0.788 0.763 0.592
2SG-21 F: TGTAGGTGCCTTCCCCATTA R: GGACTCCTGCATCTCTGCAT (GATA)10 58 33 16 0.758 0.842 0.685
2SG-55 F: CATACATGCGTGCTCAAAAA R: TGTCGGTATTGAAACATCCAA (NTAT)14 a 59 31 13 0.839 0.821 0.650
  1. aActual sequence = (CTAT)4GTAT(CTAT)2(GTATCTAT)2(CTAT)3
  2. Name of locus, primer sequence of the original cloned microsatellite, PCR reannealing temperature (°C), number of adults assayed (N), number of alleles per locus (A), observed (HO) and expected heterozygosity (HE) and exclusion probabilities (Excl. prob; given one parent known with certainty and the second parent unknown) are listed for each locus.