Skip to main content

Advertisement

Table 3 Primers used for amplifying and sequencing mitochondrial segments of zokors and fleas

From: Comparative phylogeography of the plateau zokor (Eospalax baileyi) and its host-associated flea (Neopsylla paranoma) in the Qinghai-Tibet Plateau

Primer pairs Forward (5′→3′) Reverse (5′→3′)
zokor1-F/R CCTCAACAAACAACATAA TGAAAAGGAAAATAAAAC
zokor2-F/R TTATTTCCCATATCGTTAC GTTCTCCTGGTTTTAGTTC
zokor3-F/R CAACAAACCTGGAATGAC GAGAAAGAGGCGAATAAA
flea1-F/R ACGCCCTTTCATTTTTGA AAGTTTACCTGATTCTTGAG
flea2-F/R TGGTCACCCAGAAGTA AGAAGGAAGGGCAAT
COII-F-leu/R-lys* TCTAATATGGCAGATTAGTGC GAGACCAGTACTTGCTTTCAGTCATC
  1. *According to Whiting (2002) [30].