Global analysis of saliva as a source of bacterial genes for insights into human population structure and migration studies

Table 1 Primer description

	Primer names	Sequence (5' - 3')	Reference	Target gene and group	Thermal profile¹(°C)	Amplicon size (size of analyzed fragment²)
1	gdhF	ATGGACAAACCAGCNAGYTT	[2]	gdh gene of S. oralis, S. mitis and S. infantis	94°C,30s	ca. 659 bp
					55°C,30s	ca. 659 bp
					55°C,30s	(619 bp)
	gdhR	GCTTGAGGTCCCATRCTNCC			72°C,60s	(619 bp)
2	MKR-F	TCCCGGTCAGCAAACTCCAGCC	[35]	gtfR of S. oralis	94°C,30s	ca. 374 bp
					66°C,30s	ca. 374 bp
					66°C,30s	(330 bp)
	MKR-Rv	GCAACCTTTGGATTTGCAAC			72°C,60s	(330 bp)
3	FN1164F16S	CGATGAGTAGGAGGAAGG	This study	16S-23S rRNA-ITS-gene of F. nucleatum and F. periodonticum	94°C,30s	ca. 637 bp
					52°C,30s
					72°C,60s
						(252 bp, incl. gaps)
	FN121R23S	CATTCGGAAATCCTAGAYTCTT				(252 bp, incl. gaps)

¹All PCR-assays started with an initial denaturation at 94°C for 2 min, followed by 35 cycles of the thermal profile as given in the table, with a final elongation phase at 72°C for 15 min (s = seconds).
²For analysis the primer region was omitted in the case of gdh and gtf, and in the case of the ITS the flanking 16S rRNA and 23S rRNA gene regions were omitted.

ISSN: 2730-7182