Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primer sets

From: Phylogeography of the land snail genus Orcula(Orculidae, Stylommatophora) with emphasis on the Eastern Alpine taxa: speciation, hybridization and morphological variation

Region Primer (5′ to 3′) Origin Fragment size T°C RocheTaq
COI fwd COIfolmerFw: GGTCAACAATCATAAAGATATTGG [54] 655 bp 50°C
COI rev H2198-Alb: TATACTTCAGGATGACCAAAAAATC [55]   
12S fwd 12SGastFw: TTACCTTTTGCATAATGGTTAAACTA [56] 669 - 725 bp 54°C
12S rev 12SGastRv: CGGTCTGAACTCAGATCATG [56]   
16S fwd 16SLOrc1_fwd: TTACCTTTTGCATAATGGTTAAACTA [19] 838 - 890 bp 54°C
  16SLOrc2_fwd: TTACCTTTTGCATAATGGTTAAATTA [19]   
16S rev 16SLOrc_rev: CGGTCTGAACTCAGATCATG [19]   
H4 / H3 fwd OrcH4_left1: GTGCGTCCCTGGCGCTTCA [19] 848 - 1095 bp 57°C
  OrcH4_left2: GGCGCTTCAGGGCGTACACT [19]   
H4 / H3 rev OrcH3_right1: TGGGCATGATGGTGACACGCT [56]   Finnzymes
Phusion: 71°C
intern fwd OrcH4S_left3: CGGTCTGAACTCAGATCATG [19]   
intern rev OrcH3S_right3: CGGTCTGAACTCAGATCATG [19]   
  1. Primer sequences for amplification and sequencing of the COI, 12S, 16S and H4/H3 fragments. The H4/H3 fragments were amplified with Finnzymes Phusion polymerase, wherefore the respective annealing temperatures are provided in addition.