Skip to main content

Table 5 Primers use in this study

From: Divergence at the edges: peripatric isolation in the montane spiny throated reed frog complex

Primer Sequence Origin
Cmyc 1U GAGGACATCTGGAARAARTT Crawford 2003 [61]
Cmyc H int GAACAGCTTGACATGCAGTAC Lawson 2010 [26]
Cmyc L int CTGCTCAGATTGGTCTACAGC Lawson 2010 [26]
rag1.for GCCAGATCTTTCARCCACTC This study – designed internal to Hoegg et al. 2004 [58]
rag1.rev TGATCTCTGGAACRTGGGCTA This study – designed internal to Hoegg et al. 2004 [58]