Table 1 Table shows motifs 1 and 2, their location in the mitogenome and the specific motif sequence
From: Monoplacophoran mitochondrial genomes: convergent gene arrangements and little phylogenetic signal
Motif no. | Occurrence | NCR border | Starting position within NCR | Motif sequence |
|---|---|---|---|---|
1 | L. antarctica | trnG/trnE | 55 | TATATATATATAGATATATG |
1 | Vema ewingi | trnG/trnE | 78 | TATATATATATATACATATG |
1 | L. antarctica | trnF/trnT | 893 | TATATATATATAGACTATCG |
1 | Vema ewingi | trnF/trnT | 898 | TATACATATATATACTTAGC |
2 | L. antarctica | nad2/trnC | 23 | CCTCGAAATCGTTGCATC |
2 | Vema ewingi | nad2/trnS1 | 22 | CCTCGAAATCGTTGCATC |