Skip to main content

Table 1 List of primers used to amplify across different introns in ABCB1

From: Parallel loss of introns in the ABCB1 gene in angiosperms

Primers Sequence Annealing temp. (°C) Primer location
Forward
 ABCB1_F5 GACCTCTTCCGCTTCGCCGACG 61 Exon 1
 ABCB1_F6 TTCCTCCGCTTCTTCGCCGACCTCG 61 Exon 1
 ABCB1_F8 CGCCTCGTCGTCAAGTACGCCTTC 61 Exon 1- Exon 2 boundary
 ABCB1_F22 GACGTCATCTACGCCATCAACGC 61 Exon 3
 ABCB1_F16 ACCTACTTCACCGTCTTCTGCTG 55 Exon 5
 ABCB1_F17–1 TCCGGGTCAGGGAAGAGCAC 61 Exon 6
 ABCB1_FP2 GCTCATCGAGAGGTTCTACGA 57 Exon 6
 ABCB1_F27 CAGGAGCCGACGCTGTTCGC 61 Exon 7
 ABCB1_F26 CATCAAGGAGAACCTGCTGCTGGG 61 Exon 7
 ABCB1_FP1 CATCAAGGAGAACCTGCTGCT 57 Exon 7
 ABCB1_F25 GGCGCTGGACCGCTTCATGAT 61 Exon 8
 ABCB1_F24 GCCACCAGCGCGCTGGAC 61 Exon 8
 ABCB1_F29 CTTCAGCGCCATCTTCGCCTAC 61 Exon 9
Reverse
 ABCB1_R9 GCTTCTCGCTGATGGCGTCCTG 61 Exon 3
 ABCB1_R20 TAGCAGCAGAAGACGGTGAAGTAGGT 55 Exon 5
 ABCB1_R16–2 GCCATGCTCGGAGCCGACT 61 Exon 6
 ABCB1_R19–1 TCCCCAGCAGCAGGTTCTC 61 Exon 7
 ABCB1_R25 GCGCTGGTGGCCTCGTCCA 61 Exon 8
 ABCB1_R26 CGGTCCAGCGCCTCCTGCA 61 Exon 8
 ABCB1_RP1A GATGGCGATGCGCTGCTTCTG 57 Exon 8
 ABCB1_RP1B GATGGCGATCCGCTGCTTCTG 57 Exon 8
 ABCB1_RP2 GAAGATGGCGCTGAAGGAGCC 57 Exon 9
 ABCB1_R29 CCGATGAGGAGTAGCAGTA 61 Exon 9
 ABCB1_R27 ACGTAGGCGAAGATGGCGCT 61 Exon 9
 ABCB1_R1 GCGTASGASGCGTASAGSAGGAACTG 61 Exon 10