Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 List of primers used for long-range PCR across all ABCB1 introns

From: Parallel loss of introns in the ABCB1 gene in angiosperms

Primers Sequence Annealing temp. (°C) Species in which primers were successfully used
Forward
 ABCB1_F5 GACCTCTTCCGCTTCGCCGACG 61 Zoysia
 ABCB1_F1 CGCTTCTTYGCSGABCTBGTSGACTC 61 Phyllostachys, Typha, Ecdieocolea, Mayaca, Paspalum, Streptochaeta
Reverse
 ABCB1_R4 CCGTGATCTTGCGCTCCGCGTTG 61 Zoysia
 ABCB1_R1 GCGTASGASGCGTASAGSAGGAACTG 61 Phyllostachys, Typha, Ecdieocolea, Paspalum, Streptochaeta
 ABCB1_R22 GACACCATCAGCACCATGAA 61 Mayaca