Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 List of primers used in this study

From: Enigmatic Diphyllatea eukaryotes: culturing and targeted PacBio RS amplicon sequencing reveals a higher order taxonomic diversity and global distribution

Primer name Primer direction Primer sequence (5′-3′) Tm (°C) Annealing site (5′-3′) Reference or source
NSF83 F GAAACTGCGAATGGCTCATT 49.7 84–103 [73]
Diphy257F F AAGWGGARTCATAATAACTTTTGCG 51.1 257–281 This study
Diphy453F F CGCAAATTACCCAATCCTG 48.9 453–471 This study
Diphy1881R R CGACCAAAACTCCAAAGATTTC 51.1 1860–1881 This study
1528R R TGATCCTTCTGCAGGTTCACCTAC 57.4 2127–2150 Adapted from [74]
SR1 R CGGTACTTGTTCGCTATC 48 3565–3583 Ema Chao pers. comm
LR11 R GCCAGTTATCCCTGTGGTAA 51.8 6414–6433 [75]
  1. Primer annealing site is based on Collodictyon KIVT02 sequence, start is 83 bp prior to account for NSF83s annealing site. Tm is calculated using oligocalc [52]. Primers used for Sanger sequencing are listed in Additional file 1: Table S1. The 18S rRNA gene primers Diphy257F and Diphy1881R are Diphyllatea-specific