Skip to main content

Table 1 nSSR summary information on each locus

From: The role of genetic diversity in the evolution and maintenance of environmentally-cued, male alternative reproductive tactics

Locus Nucleotide repeat Size (bp) Primer sequence nA Ta (°C) Pc (μM) HO HS p
Rrms18 CATT 130–143 F: GCTTTCATTGTTGTACACCTC 4 53 3 0.171 0.488 <0.001
Rrms34 TGAA 106–136 F: AATAATGTTTCGCACTGAGAG 11 53 15 0.748 0.772 0.183
Rrms40 CACT 85–118 F: GTAATGGCCATGTCACTAGC 9 53 10 0.246 0.577 <0.001
Rrms44 GAGT 91–98 F: CTATGTTGAAAAGGCATCAAT 3 51 15 0.438 0.404 0.108
Rrms72 CATT 128–142 F: GAAATGTCAAAGACGAAAGTG 8 51 15 0.707 0.711 <0.05
Rrms91 GAGT 84–92 F: CTATGTTGAAAAGGCATCAAT 4 51 5 0.587 0.625 <0.001
  1. Marker names, type of repetitive motif, size range of alleles (bp), primer sequences (forward - F, reverse - R), number of alleles (nA), annealing temperature (Ta), primer concentration used in PCR amplification (Pc), and observed (HO) and expected (HS) heterozygosities, with corresponding p-values