Skip to main content

Advertisement

Table 2 15 new primer pairs developed in the present study. The other 26 tested primers developed by [27] can be found in the additional file section, Additional file 1: Table S1

From: Molecular genetic diversity and differentiation of Nile tilapia (Oreochromis niloticus, L. 1758) in East African natural and stocked populations

LocusF: Primer sequence (5′-3′)R: Primer sequence (5′-3′)Repeat motifAsr
Ti39TACCTGCCAGTCATGTGCTGTGCTCAGACTGGTCCCTTCT(ATGG)8368–420
Ti41TCGCAGCTGCTCCTGTTTAATTGTGCACGTGGACATGTTG(AAAC)11381–471
Ti43ATTGCCATCACCAGGAACCATGCTAGCCCAGAGCATTTGA(GAATA)6425–478
Ti44TGCTCCTGACTCAGCATCACGCAGCACTCTGACATGAAGC(GAAAA)6419–469
Ti49TCGAAGTAGCGTGGAAAACCTACAACAACAACAGGTCGGGA(TGT)8395–403
Ti50CCTGTGACAGACTGGTGACCACACTGATGCGGTTTACGGT(ATGG)7442–517
Ti51TGCTAAACGCCAGCTGATGATTACCACACGATGTCGCAGG(TGT)8401–428
Ti52GAGAAACGTCCAGTGGCAGATTTCGATCTGCTGCCCCTTT(TAT)8373–429
Ti54TTTCTTGCCAGCAAAAACAGTCAGATTCTTCCAGTGCTTGTGC(GGAT)7390–480
Ti55GAGCCCAGACAGCAGACAATAGGACCTTCTATGGCCCTGT(TCTA)7417–491
Ti56TGCAGTGAATTTGGCACCTGAGCCTGAGATACCTGTGCCT(TGTT)6310–462
Ti57CAGTGGGAGGAAGCTCCAAAGCTGCATGGATCCAATAGGC(TCCA)7400–444
Ti59ATGGACTTAAGCTGCACCCCTGAGCATTTGACCCCAGCAT(AGGA)6429–461
Ti60GAGCCGCCATAGTGTCACTTCCTGCTCTCACTCAAAGAGGG(ATCC)7473–516
Ti61GCTACACAGGAAAGCAGAGCACTCAATGCTGGACGTGACC(TGGA)6474–501
  1. F Forward and R Reverse, Asr Allelic size range.