From: Genetic analysis of hybridization and introgression between wild mongoose and brown lemurs
Primer | Sequence 5'-3' | Map position* | F/R | A | S |
---|---|---|---|---|---|
283 | tacactggtcttgtaaacc | 15908–15926 | F | x | x |
LemurDLF1 | aagcctagtccatacgcatataagc | 16181–16205 | F | x | x |
LemurDLR2 | ggtagattaagctacgatc | 16303–16321 | R | x | x |
LemurDLR4 | atctcYtatgtccttcaagcat | 219–240 | R | x | x |
282 | aaggctaggaccaaacct | 651–668 | R | x |  |
ND4F | taggaggataYggRataatacg | 11472–11493 | F | x | x |
ND4R | atagatattagggtattttctcg | 12053–12075 | R | x | x |