Skip to main content

Table 3 Sequences of primer pairs with Nextera Illumina adaptors. Target, product size, and reaction conditions for real-time PCR assays were the same for both primers

From: eDNA metabarcoding reveals biodiversity and depth stratification patterns of dinoflagellate assemblages within the epipelagic zone of the western Coral Sea

Primer and adaptor sequences

Target

Product size

Thermocycling conditions

Forward Primer V418SNextFor:

18 S rRNA

V4

378 bp

5 min at 95 °C,

30 × (30 s at 95 °C, 30 s at 55.2 °C, 30 s at 72 °C),

5 min at 72 °C.

 5’-[TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG]

 CCAGCASCYGCGGTAATTCC-3’

Reverse primer V418SNextRev:

 5’-[GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG]

 ACTTTCGTTCTTGATYRATGA-3’