Skip to main content

Advertisement

Table 1 Primers used for sequencing and for determining in which clade alleles fall.

From: A Δ11 desaturase gene genealogy reveals two divergent allelic classes within the European corn borer (Ostrinia nubilalis)

Primer name Purpose Sequence
403f amplification and sequencing GCTGTATTTGGGATTTACATCAG
781r amplification and sequencing TGGAACGCTTTGTTTCGTTCTC
550f sequencing CATRGTGTTTAACAGCATGGC
I267f sequencing AATACCCTCWGCAAAAGTCTA
ExonAf A clade specific TTATGGAGCCACAGAAGCTAC
ExonBf B clade specific CTATGGAGTCATAGAAGCTAT
IntronAr A clade specific GTCGGTCATTGGGTGTTTGTAG
IntronBr B clade specific GCCGGTCTAGTTGTGCTTGTAG
  1. Mismatches between clade specific primers are in bold.