Skip to main content

Advertisement

Table 1 PCR annealing temperatures, sequence length, and primer sequences

From: Asymmetric reproductive isolation between terminal forms of the salamander ring species Ensatina eschscholtzii revealed by fine-scale genetic analysis of a hybrid zone

Locus Annealing temp. Length/ # variable sites (bp) PCR primer Primer sequence (5'-3')
ND4 48°C RFLP ND4 CACCTATGACTACCAAAAGCTCATGTAGAAGC
    LEU ACCACGTTTAGGTTCATTTTCATTAC
CXCR4 55°C 116/4 CXCR4F2 TGGTCTGTGGATGCTGTCAT
    CXCR4R TGCAGTAGCAGATCAAGATGA
SLC8A3 58°C 342/6 SLC8A3F CATTCGGGTCTGGAATGAAA
    SLC8A3R ACACCACCATCCCCTCTGTA
RAG1 56°C 359/7 Amp F1 ACAGGATATGATGARAAGCTTGT
    RAG1R TTRGATGTGTAGAGCCAGTGGTGYTT