Skip to main content

Advertisement

Table 5 Primers used to detect expression of zebrafish β subunit genes and splice variants in different tissues of the adult zebrafish.

From: Molecular cloning and analysis of zebrafish voltage-gated sodium channel beta subunit genes: implications for the evolution of electrical signaling in vertebrates

Forward Primer (5'-3') Reverse Primer (5'-3') Gene Variant Amplicon Size (bp)
CTACACTTATGCAGAAATGACAGCCAGC GATGGACAGAGCTTCAAGCTTTTGGCT zβ1 A 422
   zβ1 D 494
GACAGAATCCTCATCTTCCCCAACTATG CTGCATTCTTCATTTAAACTCAGAGGT zβ1 B 267
   zβ1 D 534
GTCCCTGCGCTGTTGTGTTTAACACAT GGGTGAACAATCCCTTTAAGCTGCACT zβ1 C 382
CAGCTGACAGACGAGGGCATCTACAACT CAACACCTGCAGTGAGAAAACCCCATT zβ2 A 201
CATCCTTGCTCTGCTCATTCTGTCCAT TCGCTACACGATAATACCAGGGAGTGT zβ2 B 304
   zβ2 C 169
   zβ2 D 236
CTGGTGTGTGTGGATGTGCCATCA CTTGTTGGCGGAAAGCTTGAATGA zβ3 - 357
AGGTGAGCACAGGGAAGGTCCATT GGAGGCCATTTTCTGTGTTGTCGT zβ4 loc1 543
TGTGTTGTGTTCATGCTTTG GACCACCTTTAGTTCCTCTA zβ4 loc2 395
  1. Note: several primer pairs detected multiple splice variants, as indicated above and displayed in Figure 5. BP = base pairs or nucleotide number.