Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Polymorphic markers differentiating N2 and DR1350

From: Quantitative genetic analysis of life-history traits of Caenorhabditis elegans in stressful environments

   Name N2/DR1350 Location Forward Reverse Enzyme
I 1 pkP1003 G/A 126950 gtatcctcatccttctaccacc gcgtcgttccacgtgttatgc Rsa I
  2 pkP1098 C/T 360847 tatcatgctggcgtagatttc tggataaaaagcgtttctgg Hpa II
  3 pkP1051 A/T 825028 cctacaacaggcaaagaagc aattcctaccaaagctccgc Ssp I
  4 pkP1102 C/A 1517890 tggaaggatattgtggcg ctgaacgcgattctcctgtg Hinf I
  5 pkP1016 T/G 1882334 gacaatgaccaataagacg gatccgtgaaattgttccg Bsr I
  6 snp_F28H1[1] C/T 3989631 tgccaaaatagcagtaggc tgaaactgcaataacataacg Hpy CH4V
II 1 W08F4/33109 T/C 593962 cagacttccaccgtaccattg gagacgaaacgatttacgagg Dra I
  2 pkP2134 C/T 862482 atcaggatccggaacagtcg tcgtaaatggtcagttttgg Dde I
  3 pkP2010 T/C 1129821 taatttctagcaccagtgaggc cccaaatttccacctgtaatcc Dde I
  4 pkP2015 A/G 1640462 gtacctaccgtcattgatagtg ctttcagtggacagaatccg Pvu II
  5 pkP2136 C/T 1683953 agttgtgttatacttgttgg tgtctaactgaagagatgacg Xba I
  6 T05A8/28596 G/A 2631509 ctatggtgcatcgaagtgtc gtcagcacgttcttaaccttg Bam HI
  7 pkP2026 T/C 2737466 cgatggattatgtggtgagtc caggttggtcatcatttcagac Sty I
  8 pkP2114 C/G 2755074 tcacgtcgtcacctacgcc aatctgaccaaggtatcgg Alu I
  9 nP133 -/TTCCG 2769667–8 aacgttcaaaagtgataggtc ttctcactcggtgtactcgg Eco RI
  10* snp_Y25C1A[1] C/A 3077209 accgtctttcagcgctcgacg caaaattctgctgataatgg HpyCH 4V
  11 F19B10/12159 G/T 3660181 ctgcttctctgcaagtctgc cttggaacagtctctcaacg Dra II
  12* snp_C49D10[3] A/T 3868386 agaacatctatcacgacttgg tttgtgtcatatttgcgtcc Tsp509 I
  13 pkP2051 G/A 4299265 gcgtgttttttccgtcgatcg cagcgtccagactggtttgg Hae II
  14* snp_B0304[5] GG/TT 4526832–3 acatcaccaattacacgacc agatcgtacttattgtagcc Eco 0109I
  15 C18A3/8661 G/A 5710053 catgtggacgacgtgtactgg caatgtgcagtcgtctactgg Pvu I
  16 K10B2/5930 C/T 6362593 ccttgtactcgggaacacgc gaatcagtcaaacgctgcgg Sfu I
  17 pkP2109 C/T 9401077 tgaacccataacagcttctgc aactcgtgcgctctccttgg Eco RI
  18 pkP2069 G/T 10489659 tcaaccttcatacgtgtcgc ggaatgactgataaaggtgtcg Xba I
  19 snp_W01G7[1] G/C 14044928 tatataggtacctaaagagc atttttgtccccttatatgg Cac 8I
III 1 pkP3002 A/T 743326 ctgcttatagtcttcctgtcg gcaaccccaccttcaatgac Ssp I
  2 snp_Y46E12[4] T/C 1765120 tctaatgttttttccaatcagc tatgattttactgctgctgg Ssp I
  3 pkP3099 T/C 5625446 tctttcagtgggctaacacc tgcgtgggcagcccaaatacg Hpy CH4V
  4 B0361/15143 A/C 7279588 gtatttcttacccgagagtcc cagttcacctggaatctcaatc Dde I
  5 snp_C50C3[2] G/A 8180784 gctcttcttggtacgttccc cgcgtcttctgagtgtttcc Alu I
  6 snp_T05G5[1] T/A 9742847 cgtaaactaccaaactcggtg ggtctactacaactatacaggc Dra I
  7 pkP3059 A/G 10613168 actcggccacgtggcaagc aaagcctttcggaacttcc Xba I
  8 snp_F56A8[1] C/T 13247630 tttggaggaccatcagagg tggctcaccttctttctcc Sau 3A
X 1 snp_T23F2[1] T/A 5492084 tttccggcagatgcaccacg tgcaaatagctgatcactgg Dde I
  21 C03B1/38853–6 TATA/CG 6374380–3 cgtagagacgcaaaataggc gctcaatttcacgcgtccag Acc I
  31 C25B8/5416 C/G 6374374 gtatctgagatagggtgcgc cggaaaacctgttagacatgg Xba I
  41 F41C6/10186 A/G 6879298 gtttggtcgctggagttttgg catcaaagaggcaacaagggg Fsi I
  52 pkP6158 C/T 8691678 aagacacccatccatgcatatc caattgtcagccgttgtttc Hind III
  62 pkP6030 T/G 8814093 gtaatcggttactgtgcactg ctacatcaatgtcaacaccagc Dde I
  7 pkP6137 C/T 9677614 gccttggagagtctcgatttg ttctgaccaccatagccgaac Hinf I
  8 pkP6039 T/C 10652947 cctcatctcatctttgcttg caagatgacttgccgattcatg Mse I
  9 snp_F23D12[1] T/C 14429597 taaacagaaaaattcacaaa t/c atatttgaatggagtttcacc
  10 pkP6167 C/T 15106709 taatagccgccaaagtgcg gtgaagcaagtttgattttcc Hinf I
  11 snp_C02C6[7] A/G 15561287 ttcgcgcatttatcttgtcc tatattcattgatctaagtgc Hpy CH4V
  12 pkP6096 A/T 16389174 gattgaacatagctcacagc tttcgatcgttttggacgcc Rsa I
  1. For chromosomes I, II, III and X, for each polymorphism, its name, the N2/DR1350 polymorphism, its physical location in N2 [23], the forward and reverse PCR oligonucleotide primers (5'-3') and, where appropriate, the restriction enzyme used for genotyping. * denotes markers only used in the analysis of the NILs. 1 and 2 denote two groups of markers that could not be separated genetically. † denotes the marker scored in the RILs by allele specific PCR.