Skip to main content

Advertisement

Table 1 List of primers used to amplify and sequence gene fragments in this study

From: Biogeography, phylogeny, and morphological evolution of central Texas cave and spring salamanders

Primer name Primer sequence (5’-3’) Amplified region
PGLU GAARAAYCANTRTTGTATTCAAC Cytb
PGLU-TAT** GAARAAYCANTRTTGTATTCAACTAT Cytb
MVZ-15 [27] GAACTAATGGCCCACACWWTACGNAA Cytb
HEM-CB1-5’ CCATCCAACATCTCAGCATGATGAAA Cytb
CYTBTN5Fv2 CATATTTAGGRGAAACACTTGTTCA Cytb
CYTBTYPHmR GTCKGGGYTAGAATTAATTCCTG Cytb
EurTXCRThr GYCAATGTTTTTCTAAACTACAACAGCATC Cytb
METf L4437 AAGCTTTTGGGCCCATACC ND2
COIr H5934 TGCCAATATCTTTGTGATTTGTT ND2
ND2f L5002* AATCAACCACAAATCCGAAAAAT ND2
ASNr H5692* TTAGGTATTTAGCTGTTAA ND2
MVZ 202** [28] GCGTCWGGGTARTCTGAATATCGTCG ND2
  1. ND2 includes adjacent Ala and Trp tRNA genes.
  2. *indicates primer was only used for sequencing, and not PCR.
  3. ** indicates external primer for nested PCR.